miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-1-3p
miRNA Stemloop AC MI0000437 | MI0000651
miRNA Stemloop ID hsa-mir-1-2 | hsa-mir-1-1
Sequence uggaauguaaagaaguauguau
TTD Target(s) Regulated by This miRNA Glucose-6-phosphate dehydrogenase (G6PD) Successful Target Target Info [1]
Proto-oncogene c-Met (MET) Successful Target Target Info [2]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [3]
Histone deacetylase 4 (HDAC4) Clinical trial Target Target Info [2]
Serine/threonine-protein kinase pim-1 (PIM1) Clinical trial Target Target Info [4]
Mitochondrial matrix protein P1 (HSPD1) Clinical trial Target Target Info [5]
Brain-derived neurotrophic factor (BDNF) Clinical trial Target Target Info [1]
Gap junction alpha-1 protein (GJA1) Clinical trial Target Target Info [6]
Hyperpolarization cyclic nucleotide-gated channel 2 (HCN2) Literature-reported Target Target Info [7]
Hyperpolarization cyclic nucleotide-gated channel 4 (HCN4) Literature-reported Target Target Info [7]
Inward rectifier potassium channel Kir2.1 (KCNJ2) Literature-reported Target Target Info [8]
Protein(s) Regulated by This miRNA 14-3-3 protein zeta/delta Regulated Protein
1433Z_HUMAN
[9]
Apoptosis inhibitor 5 Regulated Protein
API5_HUMAN
[10]
Baculoviral IAP repeat-containing protein 1 Regulated Protein
BIRC1_HUMAN
[11]
BAG family molecular chaperone regulator 4 Regulated Protein
BAG4_HUMAN
[12]
Calmodulin-2 Regulated Protein
CALM2_HUMAN
[13]
Calmodulin-3 Regulated Protein
CALM3_HUMAN
[14]
Calponin-3 Regulated Protein
CNN3_HUMAN
[15]
CCAAT/enhancer-binding protein alpha Regulated Protein
CEBPA_HUMAN
[2]
Cullin-associated NEDD8-dissociated protein 1 Regulated Protein
CAND1_HUMAN
[17]
Double-stranded RNA-specific adenosine deaminase Regulated Protein
DSRAD_HUMAN
[17]
Exportin-6 Regulated Protein
XPO6_HUMAN
[18]
Fatty acid-binding protein, heart Regulated Protein
FABPH_HUMAN
[19]
Fibroblast growth factor receptor substrate 2 Regulated Protein
FRS2_HUMAN
[20]
Forkhead box protein P1 Regulated Protein
FOXP1_HUMAN
[21]
Heart- and neural crest derivatives-expressed protein 2 Regulated Protein
HAND2_HUMAN
[13]
Heat shock 70 kDa protein 4 Regulated Protein
HSP74_HUMAN
[5]
Kinesin-like protein KIF2A Regulated Protein
KIF2A_HUMAN
[17]
La-related protein 4 Regulated Protein
LARP4_HUMAN
[15]
LIM and SH3 domain protein 1 Regulated Protein
LASP1_HUMAN
[23]
Myocardin Regulated Protein
MYCD_HUMAN
[24]
Myocyte-specific enhancer factor 2A Regulated Protein
MEF2A_HUMAN
[13]
Myocyte-specific enhancer factor 2A Regulated Protein
MEF2A_HUMAN
[14]
Neuropilin and tolloid-like protein 2 Regulated Protein
NETO2_HUMAN
[17]
Paired box protein Pax-3 Regulated Protein
PAX3_HUMAN
[25]
Phosphoglucomutase-2 Regulated Protein
PGM2_HUMAN
[17]
Pogo transposable element with KRAB domain Regulated Protein
POGK_HUMAN
[17]
Potassium voltage-gated channel subfamily E member 1 Regulated Protein
KCNE1_HUMAN
[26]
Potassium voltage-gated channel subfamily E member 1 Regulated Protein
KCNE1_HUMAN
[13]
Prostaglandin G/H synthase 1 Regulated Protein
PGH1_HUMAN
[27]
Protein argonaute-1 Regulated Protein
AGO1_HUMAN
[28]
Prothymosin alpha Regulated Protein
PTMA_HUMAN
[18]
Serine/arginine-rich splicing factor 9 Regulated Protein
SRSF9_HUMAN
[13]
Serum response factor Regulated Protein
SRF_HUMAN
[24]
Sprouty-related, EVH1 domain-containing protein 1 Regulated Protein
SPRE1_HUMAN
[29]
Stress-associated endoplasmic reticulum protein 1 Regulated Protein
SERP1_HUMAN
[17]
Sulfiredoxin-1 Regulated Protein
SRXN1_HUMAN
[17]
Transcription factor GATA-6 Regulated Protein
GATA6_HUMAN
[13]
Transcription factor SOX-6 Regulated Protein
SOX6_HUMAN
[30]
Transcription factor SOX-9 Regulated Protein
SOX9_HUMAN
[31]
Transgelin-2 Regulated Protein
TAGL2_HUMAN
[15]
Twinfilin-1 Regulated Protein
TWF1_HUMAN
[32]
Twinfilin-2 Regulated Protein
TWF2_HUMAN
[32]
Twist-related protein 1 Regulated Protein
TWST1_HUMAN
[33]
V-type proton ATPase subunit B, brain isoform Regulated Protein
VATB2_HUMAN
[15]
Zinc finger protein SNAI2 Regulated Protein
SNAI2_HUMAN
[34]
References
REF 1 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 2 Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem. 2008 Nov 28;283(48):33394-405.
REF 3 miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9.
REF 4 Investigational agent MLN9708/2238 targets tumor-suppressor miR33b in MM cells.Blood.2012 Nov 8;120(19):3958-67.
REF 5 The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, HSP70 and caspase-9 in cardiomyocytes. J Cell Sci. 2007 Sep 1;120(Pt 17):3045-52.
REF 6 MIR-206 regulates connexin43 expression during skeletal muscle development. Nucleic Acids Res. 2006;34(20):5863-71.
REF 7 Down-regulation of miR-1/miR-133 contributes to re-expression of pacemaker channel genes HCN2 and HCN4 in hypertrophic heart. J Biol Chem. 2008 Jul 18;283(29):20045-52.
REF 8 The muscle-specific microRNA miR-1 regulates cardiac arrhythmogenic potential by targeting GJA1 and KCNJ2. Nat Med. 2007 Apr;13(4):486-91.
REF 9 Extracellular vesicles modulate the glioblastoma microenvironment via a tumor suppression signaling network directed by miR-1.Cancer Res. 2014 Feb 1;74(3):738-750.
REF 10 MicroRNA-1 promotes apoptosis of hepatocarcinoma cells by targeting apoptosis inhibitor-5 (API-5).FEBS Lett. 2015 Jan 2;589(1):68-76.
REF 11 Downregulation of microRNA-1 and microRNA-145 contributes synergistically to the development of colon cancer.Int J Mol Med. 2015 Dec;36(6):1630-8.
REF 12 The PI3K/mTOR dual inhibitor BEZ235 suppresses proliferation and migration and reverses multidrug resistance in acute myeloid leukemia.Acta Pharmacol Sin. 2017 Mar;38(3):382-391.
REF 13 Dysregulation and cellular mislocalization of specific miRNAs in myotonic dystrophy type 1. Neuromuscul Disord. 2011 Feb;21(2):81-8.
REF 14 MicroRNA-1 negatively regulates expression of the hypertrophy-associated calmodulin and Mef2a genes.Mol Cell Biol. 2009 Apr;29(8):2193-204.
REF 15 Computational prediction and experimental validation of evolutionarily conserved microRNA target genes in bilaterian animals. BMC Genomics. 2010 Feb 9;11:101.
REF 16 Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem. 2008 Nov 28;283(48):33394-405.
REF 17 Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature. 2005 Feb 17;433(7027):769-73.
REF 18 MicroRNA-1 is a candidate tumor suppressor and prognostic marker in human prostate cancer.Nucleic Acids Res. 2012 Apr;40(8):3689-703.
REF 19 The circulating level of FABP3 is an indirect biomarker of microRNA-1.J Am Coll Cardiol. 2013 Jan 8;61(1):88-95.
REF 20 Overexpression of microRNA-1 promotes cardiomyocyte commitment from human cardiovascular progenitors via suppressing WNT and FGF signaling pathways.J Mol Cell Cardiol. 2013 Oct;63:146-54.
REF 21 Methylation mediated silencing of MicroRNA-1 gene and its role in hepatocellular carcinogenesis.Cancer Res. 2008 Jul 1;68(13):5049-58.
REF 22 The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, HSP70 and caspase-9 in cardiomyocytes. J Cell Sci. 2007 Sep 1;120(Pt 17):3045-52.
REF 23 The tumor-suppressive function of miR-1 by targeting LASP1 and TAGLN2 in esophageal squamous cell carcinoma.J Gastroenterol Hepatol. 2016 Feb;31(2):384-93.
REF 24 MicroRNA-1 inhibits myocardin-induced contractility of human vascular smooth muscle cells.J Cell Physiol. 2010 Nov;225(2):506-11.
REF 25 MyoD regulates apoptosis of myoblasts through microRNA-mediated down-regulation of Pax3.J Cell Biol. 2010 Oct 18;191(2):347-65.
REF 26 Transcriptional activation by stimulating protein 1 and post-transcriptional repression by muscle-specific microRNAs of IKs-encoding genes and pote... J Cell Physiol. 2007 Aug;212(2):358-67.
REF 27 MicroRNA directly enhances mitochondrial translation during muscle differentiation.Cell. 2014 Jul 31;158(3):607-19.
REF 28 The Gcm/Glide molecular and cellular pathway: new actors and new lineages.Dev Biol. 2013 Mar 1;375(1):65-78.
REF 29 MicroRNA-1 enhances the angiogenic differentiation of human cardiomyocyte progenitor cells.J Mol Med (Berl). 2013 Aug;91(8):1001-12.
REF 30 MicroRNA-1 and -499 regulate differentiation and proliferation in human-derived cardiomyocyte progenitor cells.Arterioscler Thromb Vasc Biol. 2010 Apr;30(4):859-68.
REF 31 Roles of miR-1-1 and miR-181c in ventricular septal defects. Int J Cardiol. 2013 Sep 30;168(2):1441-6.
REF 32 Attenuation of microRNA-1 derepresses the cytoskeleton regulatory protein twinfilin-1 to provoke cardiac hypertrophy.J Cell Sci. 2010 Jul 15;123(Pt 14):2444-52.
REF 33 EGF Receptor Promotes Prostate Cancer Bone Metastasis by Downregulating miR-1 and Activating TWIST1.Cancer Res. 2015 Aug 1;75(15):3077-86.
REF 34 MicroRNA-1 (miR-1) inhibits chordoma cell migration and invasion by targeting slug.J Orthop Res. 2014 Aug;32(8):1075-82.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.