miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-105-5p | ||||
| miRNA Stemloop AC | MI0000111 | MI0000112 | ||||
| miRNA Stemloop ID | hsa-mir-105-1 | hsa-mir-105-2 | ||||
| Sequence | ucaaaugcucagacuccuguggu | ||||
| TTD Target(s) Regulated by This miRNA | Toll-like receptor 2 (TLR2) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Nuclear receptor coactivator 1 | Regulated Protein | [2] | ||
| Tight junction protein ZO-1 | Regulated Protein | [3] | |||
| Transcription factor SOX-9 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | Modulation of TLR2 protein expression by miR-105 in human oral keratinocytes. J Biol Chem. 2009 Aug 21;284(34):23107-15. | ||||
| REF 2 | High expression of miR-105-1 positively correlates with clinical prognosis of hepatocellular carcinoma by targeting oncogene NCOA1.Oncotarget. 2017 Feb 14;8(7):11896-11905. | ||||
| REF 3 | Cancer-secreted miR-105 destroys vascular endothelial barriers to promote metastasis.Cancer Cell. 2014 Apr 14;25(4):501-15. | ||||
| REF 4 | MicroRNA-105 targets SOX9 and inhibits human glioma cell progression.FEBS Lett. 2016 Dec;590(23):4329-4342. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.