miRNA General Information
miRNA Mature ID	hsa-miR-1228-5p
miRNA Stemloop AC	MI0006318
miRNA Stemloop ID	hsa-mir-1228
Sequence	gugggcgggggcaggugugug
TTD Target(s) Regulated by This miRNA	Macrophage migration inhibitory factor (MIF)	Clinical trial Target	Target Info	[1]
References
REF 1	microRNA-1228 /sup> impairs the pro-angiogenic activity of gastric cancer cells by targeting macrophage migration inhibitory factor. Life Sci. 2017 Jul 1;180:9-16.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.