miRNA General Information
miRNA Mature ID	hsa-miR-124-3p
miRNA Stemloop AC	MI0000443 | MI0000444 | MI0000445
miRNA Stemloop ID	hsa-mir-124-1 | hsa-mir-124-2 | hsa-mir-124-3
Sequence	uaaggcacgcggugaaugcc
TTD Target(s) Regulated by This miRNA	Cyclin-dependent kinase 6 (CDK6)	Successful Target	Target Info	[1]
	Enhancer of zeste homolog 2 (EZH2)	Successful Target	Target Info	[2]
	Rho-associated protein kinase 2 (ROCK2)	Successful Target	Target Info	[3]
	Beta-secretase 1 (BACE1)	Clinical trial Target	Target Info	[4]
	Brain-derived neurotrophic factor (BDNF)	Clinical trial Target	Target Info	[5]
	Deneddylase-1 (SENP8)	Literature-reported Target	Target Info	[6]
	Protein kinase D (PRKD1)	Literature-reported Target	Target Info	[6]
	ETS domain-containing protein Elk-3 (ELK3)	Literature-reported Target	Target Info	[7]
	Monocarboxylate transporter 1 (SLC16A1)	Literature-reported Target	Target Info	[8]
Protein(s) Regulated by This miRNA	3-ketoacyl-CoA thiolase, mitochondrial	Regulated Protein	THIM_HUMAN	[8]
	Adiponectin receptor protein 2	Regulated Protein	PAQR2_HUMAN	[10]
	Angiomotin-like protein 1	Regulated Protein	AMOL1_HUMAN	[11]
	Astrocytic phosphoprotein PEA-15	Regulated Protein	PEA15_HUMAN	[12]
	Beta-1,4-galactosyltransferase 1	Regulated Protein	B4GT1_HUMAN	[13]
	Calmodulin-binding transcription activator 1	Regulated Protein	CMTA1_HUMAN	[14]
	Calpain small subunit 1	Regulated Protein	CPNS1_HUMAN	[15]
	Carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 1	Regulated Protein	CTDS1_HUMAN	[16]
	CCAAT/enhancer-binding protein alpha	Regulated Protein	CEBPA_HUMAN	[17]
	CD151 antigen	Regulated Protein	CD151_HUMAN	[18]
	Charged multivesicular body protein 2b	Regulated Protein	CHM2B_HUMAN	[19]
	Circadian locomoter output cycles protein kaput	Regulated Protein	CLOCK_HUMAN	[20]
	E3 ubiquitin-protein ligase UHRF1	Regulated Protein	UHRF1_HUMAN	[21]
	Elongation of very long chain fatty acids protein 5	Regulated Protein	ELOV5_HUMAN	[8]
	Ephrin-B1	Regulated Protein	EFNB1_HUMAN	[22]
	Flotillin-1	Regulated Protein	FLOT1_HUMAN	[23]
	Frataxin, mitochondrial	Regulated Protein	FRDA_HUMAN	[24]
	G1/S-specific cyclin-D2	Regulated Protein	CCND2_HUMAN	[25]
	GAS2-like protein 1	Regulated Protein	GA2L1_HUMAN	[8]
	Hepatocyte nuclear factor 3-beta	Regulated Protein	FOXA2_HUMAN	[26]
	Histone-lysine N-methyltransferase SMYD3	Regulated Protein	SMYD3_HUMAN	[27]
	Interleukin-6 receptor subunit alpha	Regulated Protein	IL6RA_HUMAN	[28]
	Krueppel-like factor 6	Regulated Protein	KLF6_HUMAN	[29]
	Laminin subunit gamma-1	Regulated Protein	LAMC1_HUMAN	[8]
	Magnesium transporter protein 1	Regulated Protein	MAGT1_HUMAN	[8]
	Myotrophin	Regulated Protein	MTPN_HUMAN	[10]
	NF-kappa-B inhibitor zeta	Regulated Protein	IKBZ_HUMAN	[30]
	Nuclear factor of activated T-cells, cytoplasmic 1	Regulated Protein	NFAC1_HUMAN	[14]
	Paired mesoderm homeobox protein 1	Regulated Protein	PRRX1_HUMAN	[31]
	Protein CASC3	Regulated Protein	CASC3_HUMAN	[32]
	Protein jagged-1	Regulated Protein	JAG1_HUMAN	[33]
	Ras GTPase-activating-like protein IQGAP1	Regulated Protein	IQGA1_HUMAN	[27]
	Ras-related protein R-Ras	Regulated Protein	RRAS_HUMAN	[34]
	Ras-related protein Rab-38	Regulated Protein	RAB38_HUMAN	[35]
	Ras-related protein Rap-2a	Regulated Protein	RAP2A_HUMAN	[36]
	RE1-silencing transcription factor	Regulated Protein	REST_HUMAN	[37]
	RelA-associated inhibitor	Regulated Protein	IASPP_HUMAN	[38]
	RelA-associated inhibitor	Regulated Protein	IASPP_HUMAN	[39]
	Retinol dehydrogenase 10	Regulated Protein	RDH10_HUMAN	[40]
	Rho-related GTP-binding protein RhoG	Regulated Protein	RHOG_HUMAN	[41]
	Rho-related GTP-binding protein RhoG	Regulated Protein	RHOG_HUMAN	[42]
	Ribonucleoprotein PTB-binding 2	Regulated Protein	RAVR2_HUMAN	[8]
	Sialomucin core protein 24	Regulated Protein	MUC24_HUMAN	[8]
	Sjoegren syndrome/scleroderma autoantigen 1	Regulated Protein	SSA27_HUMAN	[43]
	Son of sevenless homolog 1	Regulated Protein	SOS1_HUMAN	[44]
	Spermine oxidase	Regulated Protein	SMOX_HUMAN	[45]
	Squamous cell carcinoma antigen recognized by T-cells 3	Regulated Protein	SART3_HUMAN	[46]
	Stress-associated endoplasmic reticulum protein 1	Regulated Protein	SERP1_HUMAN	[8]
	Succinate--CoA ligase [GDP-forming] subunit beta, mitochondrial	Regulated Protein	SUCB2_HUMAN	[8]
	Surfeit locus protein 4	Regulated Protein	SURF4_HUMAN	[8]
	Transcription factor E2F6	Regulated Protein	E2F6_HUMAN	[27]
	Tribbles homolog 3	Regulated Protein	TRIB3_HUMAN	[47]
	TSC22 domain family protein 3	Regulated Protein	T22D3_HUMAN	[48]
	Unconventional myosin-X	Regulated Protein	MYO10_HUMAN	[49]
	V-type proton ATPase subunit e 1	Regulated Protein	VA0E1_HUMAN	[8]
	Vesicle-associated membrane protein 3	Regulated Protein	VAMP3_HUMAN	[8]
	Vimentin	Regulated Protein	VIME_HUMAN	[27]
	X-ray repair cross-complementing protein 6	Regulated Protein	XRCC6_HUMAN	[50]
	Zinc finger protein SNAI2	Regulated Protein	SNAI2_HUMAN	[51]
References
REF 1	Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
REF 2	MYC stimulates EZH2 expression by repression of its negative regulator miR-26a. Blood. 2008 Nov 15;112(10):4202-12.
REF 3	Downregulation of the Rho GTPase signaling pathway is involved in the microRNA-138-mediated inhibition of cell migration and invasion in tongue squamous cell carcinoma. Int J Cancer. 2010 Aug 1;127(3):505-12.
REF 4	The expression of microRNA miR-107 decreases early in Alzheimer's disease and may accelerate disease progression through regulation of beta-site amyloid precursor protein-cleaving enzyme 1. J Neurosci. 2008 Jan 30;28(5):1213-23.
REF 5	Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 6	A biochemical approach to identifying microRNA targets. Proc Natl Acad Sci U S A. 2007 Dec 4;104(49):19291-6.
REF 7	An integrated approach for experimental target identification of hypoxia-induced miR-210. J Biol Chem. 2009 Dec 11;284(50):35134-43.
REF 8	Systematic identification of microRNA functions by combining target prediction and expression profiling. Nucleic Acids Res. 2006 Mar 20;34(5):1646-52. Print 2006.
REF 9	Systematic identification of microRNA functions by combining target prediction and expression profiling. Nucleic Acids Res. 2006 Mar 20;34(5):1646-52. Print 2006.
REF 10	Combinatorial microRNA target predictions.Nat Genet. 2005 May;37(5):495-500.
REF 11	MiR-124 represses vasculogenic mimicry and cell motility by targeting amotL1 in cervical cancer cells.Cancer Lett. 2014 Dec 1;355(1):148-58.
REF 12	miR-212 increases tumor necrosis factor-related apoptosis-inducing ligand sensitivity in non-small cell lung cancer by targeting the antiapoptotic protein PED.Cancer Res. 2010 May 1;70(9):3638-46.
REF 13	MiR-124-3p/B4GALT1 axis plays an important role in SOCS3-regulated growth and chemo-sensitivity of CML.J Hematol Oncol. 2016 Aug 12;9(1):69.
REF 14	MicroRNA-124 suppresses the transactivation of nuclear factor of activated T cells by targeting multiple genes and inhibits the proliferation of pulmonary artery smooth muscle cells.J Biol Chem. 2013 Aug 30;288(35):25414-27.
REF 15	miR-124 suppresses the migration and invasion of glioma cells in vitro via Capn4.Oncol Rep. 2016 Jan;35(1):284-90.
REF 16	The microRNA miR-124 antagonizes the anti-neural REST/SCP1 pathway during embryonic CNS development.Genes Dev. 2007 Apr 1;21(7):744-9.
REF 17	Epigenetic modification of CCAAT/enhancer binding protein alpha expression in acute myeloid leukemia.Cancer Res. 2008 May 1;68(9):3142-51.
REF 18	MicroRNA-124 suppresses breast cancer cell growth and motility by targeting CD151.Cell Physiol Biochem. 2013;31(6):823-32.
REF 19	MicroRNA-9 coordinates proliferation and migration of human embryonic stem cell-derived neural progenitors.Cell Stem Cell. 2010 Apr 2;6(4):323-35.
REF 20	Circadian gene Clock contributes to cell proliferation and migration of glioma and is directly regulated by tumor-suppressive miR-124.FEBS Lett. 2013 Aug 2;587(15):2455-60.
REF 21	MiR-124 exerts tumor suppressive functions on the cell proliferation, motility and angiogenesis of bladder cancer by fine-tuning UHRF1.FEBS J. 2015 Nov;282(22):4376-88.
REF 22	Ephrin-B1 reverse signaling controls a posttranscriptional feedback mechanism via miR-124.Mol Cell Biol. 2010 May;30(10):2508-17.
REF 23	Microrna-124 targets flotillin-1 to regulate proliferation and migration in breast cancer.Mol Cancer. 2013 Dec 13;12:163.
REF 24	Genetic variations creating microRNA target sites in the FXN 3'-UTR affect frataxin expression in Friedreich ataxia.PLoS One. 2013;8(1):e54791.
REF 25	MicroRNA-124a is epigenetically regulated and acts as a tumor suppressor by controlling multiple targets in uveal melanoma.Invest Ophthalmol Vis Sci. 2013 Mar 1;54(3):2248-56.
REF 26	MicroRNA-124a is hyperexpressed in type 2 diabetic human pancreatic islets and negatively regulates insulin secretion.Acta Diabetol. 2015 Jun;52(3):523-30.
REF 27	miR-124 and miR-203 are epigenetically silenced tumor-suppressive microRNAs in hepatocellular carcinoma. Carcinogenesis. 2010 May;31(5):766-76.
REF 28	An HNF4-miRNA inflammatory feedback circuit regulates hepatocellular oncogenesis. Cell. 2011 Dec 9;147(6):1233-47.
REF 29	microRNA-124 is down regulated in nerve-injured motor neurons and it potentially targets mRNAs for KLF6 and STAT3.Neuroscience. 2014 Jan 3;256:426-32.
REF 30	IkappaBzeta expression is regulated by miR-124a.Cell Cycle. 2009 Jul 1;8(13):2019-23.
REF 31	MiR-124 Radiosensitizes human colorectal cancer cells by targeting PRRX1.PLoS One. 2014 Apr 4;9(4):e93917.
REF 32	Methylation-regulated miR-124-1 suppresses tumorigenesis in hepatocellular carcinoma by targeting CASC3.Oncotarget. 2016 May 3;7(18):26027-41.
REF 33	Modeling SNP mediated differential targeting of homologous 3'UTR by microRNA. RNA Biol. 2012 Mar;9(3):351-60.
REF 34	MiR-124 governs glioma growth and angiogenesis and enhances chemosensitivity by targeting R-Ras and N-Ras.Neuro Oncol. 2014 Oct;16(10):1341-53.
REF 35	MiR-124 protects human hepatic L02 cells from H2O2-induced apoptosis by targeting Rab38 gene.Biochem Biophys Res Commun. 2014 Jul 18;450(1):148-53.
REF 36	miR-9 and miR-124 synergistically affect regulation of dendritic branching via the AKT/GSK3 pathway by targeting Rap2a.Sci Rep. 2016 May 25;6:26781.
REF 37	The tumor suppressor microRNA, miR-124a, is regulated by epigenetic silencing and by the transcriptional factor, REST in glioblastoma.Tumour Biol. 2014 Feb;35(2):1459-65.
REF 38	Downregulation of miR-124 promotes the growth and invasiveness of glioblastoma cells involving upregulation of PPP1R13L.Int J Mol Med. 2013 Jul;32(1):101-7.
REF 39	MicroRNA-124 regulates the proliferation of colorectal cancer cells by targeting iASPP.Biomed Res Int. 2013;2013:867537.
REF 40	Prediction and verification of miRNA expression in human and rat retinas.Invest Ophthalmol Vis Sci. 2007 Sep;48(9):3962-7.
REF 41	miR-124 suppresses multiple steps of breast cancer metastasis by targeting a cohort of pro-metastatic genes in vitro.Chin J Cancer. 2011 Dec;30(12):821-30.
REF 42	MicroRNA-124 Controls Transforming Growth Factor 1-Induced Epithelial-Mesenchymal Transition in the Retinal Pigment Epithelium by Targeting RHOG.Invest Ophthalmol Vis Sci. 2016 Jan 1;57(1):12-22.
REF 43	Functional proteomics identifies miRNAs to target a p27/Myc/phospho-Rb signature in breast and ovarian cancer.Oncogene. 2016 Feb 11;35(6):691-701.
REF 44	MiR-124 inhibits the growth of glioblastoma through the downregulation of SOS1.Mol Med Rep. 2013 Aug;8(2):345-9.
REF 45	Epigenetic silencing of miR-124 prevents spermine oxidase regulation: implications for Helicobacter pylori-induced gastric cancer.Oncogene. 2016 Oct 20;35(42):5480-5488.
REF 46	MicroRNA-124 Targets Tip110 Expression and Regulates Hematopoiesis.Stem Cells Dev. 2015 Sep 1;24(17):2009-17.
REF 47	MicroRNA-124 promotes hepatic triglyceride accumulation through targeting tribbles homolog 3.Sci Rep. 2016 Nov 15;6:37170.
REF 48	MicroRNA 18 and 124a down-regulate the glucocorticoid receptor: implications for glucocorticoid responsiveness in the brain. Endocrinology. 2009 May;150(5):2220-8.
REF 49	NF-B-mediated miR-124 suppresses metastasis of non-small-cell lung cancer by targeting MYO10.Oncotarget. 2015 Apr 10;6(10):8244-54.
REF 50	MicroRNA-124 (miR-124) regulates Ku70 expression and is correlated with neuronal death induced by ischemia/reperfusion.J Mol Neurosci. 2014 Jan;52(1):148-55.
REF 51	Loss of brain-enriched miR-124 microRNA enhances stem-like traits and invasiveness of glioma cells.J Biol Chem. 2012 Mar 23;287(13):9962-71.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.