miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-1247-5p | ||||
| miRNA Stemloop AC | MI0006382 | ||||
| miRNA Stemloop ID | hsa-mir-1247 | ||||
| Sequence | acccgucccguucguccccgga | ||||
| TTD Target(s) Regulated by This miRNA | Mixed lineage kinase 1 (MAP3K9) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Transcription factor SOX-9 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | MiRNA profile of osteosarcoma with CD117 and stro-1 expression: miR-1247 functions as an onco-miRNA by targeting MAP3K9. Int J Clin Exp Pathol. 2015 Feb 1;8(2):1451-8. | ||||
| REF 2 | miR-1247 functions by targeting cartilage transcription factor SOX9.J Biol Chem. 2013 Oct 25;288(43):30802-14. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.