miRNA General Information
miRNA Mature ID	hsa-miR-125b-5p
miRNA Stemloop AC	MI0000446 | MI0000470
miRNA Stemloop ID	hsa-mir-125b-1 | hsa-mir-125b-2
Sequence	ucccugagacccuaacuuguga
TTD Target(s) Regulated by This miRNA	Erbb2 tyrosine kinase receptor (HER2)	Successful Target	Target Info	[1]
	Cyclin-dependent kinase 6 (CDK6)	Successful Target	Target Info	[2]
	NT-3 growth factor receptor (TrkC)	Successful Target	Target Info	[3]
	Smoothened homolog (SMO)	Successful Target	Target Info	[4]
	Erbb3 tyrosine kinase receptor (Erbb-3)	Clinical trial Target	Target Info	[1]
	M-phase inducer phosphatase 1 (MPIP1)	Literature-reported Target	Target Info	[5]
	Apoptosis regulator BAK (BAK)	Literature-reported Target	Target Info	[6]
	Multiple tumor suppressor 1 (CDKN2A)	Literature-reported Target	Target Info	[7]
Protein(s) Regulated by This miRNA	Adenomatous polyposis coli protein	Regulated Protein	APC_HUMAN	[8]
	Amiloride-sensitive sodium channel subunit alpha	Regulated Protein	SCNNA_HUMAN	[9]
	Ankyrin repeat and BTB/POZ domain-containing protein 1	Regulated Protein	ABTB1_HUMAN	[10]
	Aryl hydrocarbon receptor repressor	Regulated Protein	AHRR_HUMAN	[11]
	AT-rich interactive domain-containing protein 3A	Regulated Protein	ARI3A_HUMAN	[12]
	AT-rich interactive domain-containing protein 3B	Regulated Protein	ARI3B_HUMAN	[13]
	B-cell lymphoma 3 protein	Regulated Protein	BCL3_HUMAN	[14]
	Bcl-2-modifying factor	Regulated Protein	BMF_HUMAN	[15]
	Bone morphogenetic protein receptor type-1B	Regulated Protein	BMR1B_HUMAN	[16]
	Bone morphogenetic protein receptor type-1B	Regulated Protein	BMR1B_HUMAN	[17]
	CCAAT/enhancer-binding protein alpha	Regulated Protein	CEBPA_HUMAN	[18]
	Cingulin	Regulated Protein	CING_HUMAN	[19]
	Core-binding factor subunit beta	Regulated Protein	PEBB_HUMAN	[20]
	Cyclin-dependent kinase 4 inhibitor D	Regulated Protein	CDN2D_HUMAN	[21]
	Cyclin-J	Regulated Protein	CCNJ_HUMAN	[22]
	DNA damage-regulated autophagy modulator protein 2	Regulated Protein	DRAM2_HUMAN	[23]
	Dual specificity protein phosphatase 6	Regulated Protein	DUS6_HUMAN	[24]
	E3 SUMO-protein ligase PIAS3	Regulated Protein	PIAS3_HUMAN	[25]
	E3 ubiquitin-protein ligase TRIM71	Regulated Protein	LIN41_HUMAN	[26]
	Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase	Regulated Protein	MA1B1_HUMAN	[27]
	Endoribonuclease LACTB2	Regulated Protein	LACB2_HUMAN	[28]
	Frizzled-6	Regulated Protein	FZD6_HUMAN	[29]
	Glutathione synthetase	Regulated Protein	GSHB_HUMAN	[30]
	GRB2-associated-binding protein 2	Regulated Protein	GAB2_HUMAN	[31]
	Hexokinase-2	Regulated Protein	HXK2_HUMAN	[32]
	Intercellular adhesion molecule 2	Regulated Protein	ICAM2_HUMAN	[33]
	Interferon regulatory factor 4	Regulated Protein	IRF4_HUMAN	[34]
	Interferon-inducible double-stranded RNA-dependent protein kinase activator A	Regulated Protein	PRKRA_HUMAN	[35]
	Interleukin-6 receptor subunit alpha	Regulated Protein	IL6RA_HUMAN	[36]
	Interleukin-6 receptor subunit alpha	Regulated Protein	IL6RA_HUMAN	[37]
	Keratin, type II cytoskeletal 7	Regulated Protein	K2C7_HUMAN	[38]
	Kinesin light chain 2	Regulated Protein	KLC2_HUMAN	[39]
	Krueppel-like factor 13	Regulated Protein	KLF13_HUMAN	[40]
	Matrix metalloproteinase-26	Regulated Protein	MMP26_HUMAN	[41]
	Max dimerization protein 1	Regulated Protein	MAD1_HUMAN	[42]
	Methylcytosine dioxygenase TET2	Regulated Protein	TET2_HUMAN	[43]
	Mothers against decapentaplegic homolog 4	Regulated Protein	SMAD4_HUMAN	[44]
	Multiple epidermal growth factor-like domains protein 9	Regulated Protein	MEGF9_HUMAN	[22]
	NAD-dependent protein deacetylase sirtuin-7	Regulated Protein	SIR7_HUMAN	[45]
	NF-kappa-B inhibitor-interacting Ras-like protein 2	Regulated Protein	KBRS2_HUMAN	[46]
	Nuclear receptor corepressor 2	Regulated Protein	NCOR2_HUMAN	[47]
	Phosphatidylcholine transfer protein	Regulated Protein	PPCT_HUMAN	[30]
	Phosphatidylinositol-glycan biosynthesis class F protein	Regulated Protein	PIGF_HUMAN	[48]
	Podocalyxin	Regulated Protein	PODXL_HUMAN	[49]
	PR domain zinc finger protein 1	Regulated Protein	PRDM1_HUMAN	[34]
	Protein BTG2	Regulated Protein	BTG2_HUMAN	[50]
	Protein lin-28 homolog A	Regulated Protein	LN28A_HUMAN	[51]
	Protein lin-28 homolog B	Regulated Protein	LN28B_HUMAN	[52]
	Protein SET	Regulated Protein	SET_HUMAN	[53]
	Secreted frizzled-related protein 5	Regulated Protein	SFRP5_HUMAN	[54]
	Semaphorin-4C	Regulated Protein	SEM4C_HUMAN	[55]
	StAR-related lipid transfer protein 13	Regulated Protein	STA13_HUMAN	[56]
	TBC1 domain family member 1	Regulated Protein	TBCD1_HUMAN	[57]
	Tumor protein p53-inducible nuclear protein 1	Regulated Protein	T53I1_HUMAN	[58]
	Tumor protein p53-inducible nuclear protein 1	Regulated Protein	T53I1_HUMAN	[59]
	Vacuolar protein sorting-associated protein 4B	Regulated Protein	VPS4B_HUMAN	[60]
	Vacuolar protein sorting-associated protein 51 homolog	Regulated Protein	VPS51_HUMAN	[61]
	Zinc finger protein Aiolos	Regulated Protein	IKZF3_HUMAN	[30]
	Zinc finger protein Eos	Regulated Protein	IKZF4_HUMAN	[30]
	Zinc finger protein Helios	Regulated Protein	IKZF2_HUMAN	[30]
References
REF 1	Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b. J Biol Chem. 2007 Jan 12;282(2):1479-86.
REF 2	Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
REF 3	The interplay between microRNAs and the neurotrophin receptor tropomyosin-related kinase C controls proliferation of human neuroblastoma cells. Proc Natl Acad Sci U S A. 2007 May 8;104(19):7957-62.
REF 4	Concerted microRNA control of Hedgehog signalling in cerebellar neuronal progenitor and tumour cells. EMBO J. 2008 Oct 8;27(19):2616-27.
REF 5	The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res. 2007 Aug 15;67(16):7713-22.
REF 6	An androgen-regulated miRNA suppresses Bak1 expression and induces androgen-independent growth of prostate cancer cells. Proc Natl Acad Sci U S A. 2007 Dec 11;104(50):19983-8.
REF 7	p16(INK4a) translation suppressed by miR-24. PLoS One. 2008 Mar 26;3(3):e1864.
REF 8	CXCL12/CXCR4 axis induced miR-125b promotes invasion and confers 5-fluorouracil resistance through enhancing autophagy in colorectal cancer.Sci Rep. 2017 Feb 8;7:42226.
REF 9	miR-125b inhibits hepatitis B virus expression in vitro through targeting of the SCNN1A gene.Arch Virol. 2014 Dec;159(12):3335-43.
REF 10	MicroRNA-125b transforms myeloid cell lines by repressing multiple mRNA.Haematologica. 2012 Nov;97(11):1713-21.
REF 11	miR-125b transcriptionally increased by Nrf2 inhibits AhR repressor, which protects kidney from cisplatin-induced injury.Cell Death Dis. 2013 Oct 31;4:e899.
REF 12	B-cell regulator of immunoglobulin heavy-chain transcription (Bright)/ARID3a is a direct target of the oncomir microRNA-125b in progenitor B-cells.Leukemia. 2012 Oct;26(10):2224-32.
REF 13	miR-125b targets ARID3B in breast cancer cells.Cell Struct Funct. 2012;37(1):27-38.
REF 14	MiR-125b targets BCL3 and suppresses ovarian cancer proliferation.Int J Cancer. 2011 May 15;128(10):2274-83.
REF 15	MiR-125b expression affects the proliferation and apoptosis of human glioma cells by targeting Bmf.Cell Physiol Biochem. 2009;23(4-6):347-58.
REF 16	A risk variant in an miR-125b binding site in BMPR1B is associated with breast cancer pathogenesis.Cancer Res. 2009 Sep 15;69(18):7459-65.
REF 17	MiR-125b Regulates the Osteogenic Differentiation of Human Mesenchymal Stem Cells by Targeting BMPR1b.Cell Physiol Biochem. 2017;41(2):530-542.
REF 18	The deregulated expression of miR-125b in acute myeloid leukemia is dependent on the transcription factor C/EBP.Leukemia. 2015 Dec;29(12):2442-5.
REF 19	miR-16 and miR-125b are involved in barrier function dysregulation through the modulation of claudin-2 and cingulin expression in the jejunum in IBS with diarrhoea.Gut. 2017 Sep;66(9):1537-1538.
REF 20	miR-125b, a target of CDX2, regulates cell differentiation through repression of the core binding factor in hematopoietic malignancies.J Biol Chem. 2011 Nov 4;286(44):38253-63.
REF 21	miR-125b modulates megakaryocyte maturation by targeting the cell-cycle inhibitor p19INK4D.Cell Death Dis. 2016 Oct 20;7(10):e2430.
REF 22	miR-125b acts as a tumor suppressor in breast tumorigenesis via its novel direct targets ENPEP, CK2-, CCNJ, and MEGF9.PLoS One. 2013 Oct 3;8(10):e76247.
REF 23	MicroRNA-125b promotes tumor growth and suppresses apoptosis by targeting DRAM2 in retinoblastoma.Eye (Lond). 2016 Dec;30(12):1630-1638.
REF 24	MicroRNA-125b induces tau hyperphosphorylation and cognitive deficits in Alzheimer's disease.EMBO J. 2014 Aug 1;33(15):1667-80.
REF 25	miR-125b inhibitor may enhance the invasion-prevention activity of temozolomide in glioblastoma stem cells by targeting PIAS3.BioDrugs. 2014 Feb;28(1):41-54.
REF 26	Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation.J Biol Chem. 2005 Apr 29;280(17):16635-41.
REF 27	ERManI is a target of miR-125b and promotes transformation phenotypes in hepatocellular carcinoma (HCC).PLoS One. 2013 Aug 5;8(8):e72829.
REF 28	MicroRNA-125b-5p attenuates lipopolysaccharide-induced monocyte chemoattractant protein-1 production by targeting inhibiting LACTB in THP-1 macrophages.Arch Biochem Biophys. 2016 Jan 15;590:64-71.
REF 29	A regulatory circuit of miR-125b/miR-20b and Wnt signalling controls glioblastoma phenotypes through FZD6-modulated pathways.Nat Commun. 2016 Oct 4;7:12885.
REF 30	The down-regulation of miR-125b in chronic lymphocytic leukemias leads to metabolic adaptation of cells to a transformed state. Blood. 2012 Sep 27;120(13):2631-8.
REF 31	Proteinase-activated receptor 2 promotes cancer cell migration through RNA methylation-mediated repression of miR-125b.J Biol Chem. 2015 Oct 30;290(44):26627-37.
REF 32	MicroRNA-143 (miR-143) regulates cancer glycolysis via targeting hexokinase 2 gene.J Biol Chem. 2012 Jun 29;287(27):23227-35.
REF 33	MicroRNA-125b regulates proliferation and radioresistance of oral squamous cell carcinoma.Br J Cancer. 2013 May 14;108(9):1817-21.
REF 34	MicroRNA 125b inhibition of B cell differentiation in germinal centers.Int Immunol. 2010 Jul;22(7):583-92.
REF 35	Conserved regulation of p53 network dosage by microRNA-125b occurs through evolving miRNA-target gene pairs.PLoS Genet. 2011 Sep;7(9):e1002242.
REF 36	MicroRNA-125b promotes apoptosis by regulating the expression of Mcl-1, Bcl-w and IL-6R.Oncogene. 2013 Jun 20;32(25):3071-9.
REF 37	MicroRNA-125b functions as a tumor suppressor in hepatocellular carcinoma cells.Int J Mol Sci. 2012;13(7):8762-74.
REF 38	Identification of novel microRNA targets based on microRNA signatures in bladder cancer.Int J Cancer. 2009 Jul 15;125(2):345-52.
REF 39	High expression of kinesin light chain-2, a novel target of miR-125b, is associated with poor clinical outcome of elderly non-small-cell lung cancer patients.Br J Cancer. 2015 Mar 3;112(5):874-82.
REF 40	Decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy. Genes Chromosomes Cancer. 2009 Jul;48(7):569-82.
REF 41	MiR-125b regulates endometrial receptivity by targeting MMP26 in women undergoing IVF-ET with elevated progesterone on HCG priming day.Sci Rep. 2016 May 4;6:25302.
REF 42	miR-125b promotes cell death by targeting spindle assembly checkpoint gene MAD1 and modulating mitotic progression.Cell Death Differ. 2013 Mar;20(3):430-42.
REF 43	An extensive network of TET2-targeting MicroRNAs regulates malignant hematopoiesis.Cell Rep. 2013 Oct 31;5(2):471-81.
REF 44	miR-125 potentiates early neural specification of human embryonic stem cells.Development. 2012 Apr;139(7):1247-57.
REF 45	Sirtuin7 oncogenic potential in human hepatocellular carcinoma and its regulation by the tumor suppressors MiR-125a-5p and MiR-125b.Hepatology. 2013 Mar;57(3):1055-67.
REF 46	Estradiol suppresses NF-kappa B activation through coordinated regulation of let-7a and miR-125b in primary human macrophages.J Immunol. 2010 May 1;184(9):5029-37.
REF 47	miR-125b Regulation of Androgen Receptor Signaling Via Modulation of the Receptor Complex Co-Repressor NCOR2.Biores Open Access. 2012 Apr;1(2):55-62.
REF 48	Regulation of placenta growth factor by microRNA-125b in hepatocellular cancer.J Hepatol. 2011 Dec;55(6):1339-45.
REF 49	MicroRNA-125b is involved in atherosclerosis obliterans in vitro by targeting podocalyxin.Mol Med Rep. 2015 Jul;12(1):561-8.
REF 50	Identification of miR-125b targets involved in acute promyelocytic leukemia cell proliferation.Biochem Biophys Res Commun. 2016 Sep 30;478(4):1758-63.
REF 51	miR-125b inhibits osteoblastic differentiation by down-regulation of cell proliferation.Biochem Biophys Res Commun. 2008 Apr 4;368(2):267-72.
REF 52	MicroRNA-125b suppressesed human liver cancer cell proliferation and metastasis by directly targeting oncogene LIN28B2.Hepatology. 2010 Nov;52(5):1731-40.
REF 53	MicroRNA-125b Suppresses Ovarian Cancer Progression via Suppression of the Epithelial-Mesenchymal Transition Pathway by Targeting the SET Protein.Cell Physiol Biochem. 2016;39(2):501-10.
REF 54	MiR-125b regulates SFRP5 expression to promote growth and activation of cardiac fibroblasts.Cell Biol Int. 2016 Nov;40(11):1224-1234.
REF 55	MiR-125b regulates epithelial-mesenchymal transition via targeting Sema4C in paclitaxel-resistant breast cancer cells.Oncotarget. 2015 Feb 20;6(5):3268-79.
REF 56	MicroRNA-125b induces metastasis by targeting STARD13 in MCF-7 and MDA-MB-231 breast cancer cells.PLoS One. 2012;7(5):e35435.
REF 57	MicroRNA-125b promotes neuronal differentiation in human cells by repressing multiple targets.Mol Cell Biol. 2009 Oct;29(19):5290-305.
REF 58	MiR-125b promotes proliferation and migration of type II endometrial carcinoma cells through targeting TP53INP1 tumor suppressor in vitro and in vivo.BMC Cancer. 2011 Oct 5;11:425.
REF 59	MicroRNA-125b promotes tumor metastasis through targeting tumor protein 53-induced nuclear protein 1 in patients with non-small-cell lung cancer.Cancer Cell Int. 2015 Sep 17;15:84.
REF 60	miR-125b can enhance skin tumor initiation and promote malignant progression by repressing differentiation and prolonging cell survival.Genes Dev. 2014 Nov 15;28(22):2532-46.
REF 61	miRNA-dependent cross-talk between VEGF and Ang-2 in hypoxia-induced microvascular dysfunction. Biochem Biophys Res Commun. 2014 Sep 26;452(3):428-35.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.