miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-127-3p | ||||
| miRNA Stemloop AC | MI0000472 | ||||
| miRNA Stemloop ID | hsa-mir-127 | ||||
| Sequence | ucggauccgucugagcuuggcu | ||||
| TTD Target(s) Regulated by This miRNA | PI3-kinase gamma (PIK3CG) | Successful Target | Target Info | [1] | |
| Matrix metalloproteinase-13 (MMP-13) | Clinical trial Target | Target Info | [2] | ||
| O-6-methylguanine-DNA-alkyltransferase (MGMT) | Clinical trial Target | Target Info | [3] | ||
| SET domain containing 8 (KMT5A) | Preclinical Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | B-cell lymphoma 6 protein | Regulated Protein | [5] | ||
| BAG family molecular chaperone regulator 5 | Regulated Protein | [6] | |||
| DNA repair protein XRCC3 | Regulated Protein | [7] | |||
| Mitogen-activated protein kinase 4 | Regulated Protein | [8] | |||
| PR domain zinc finger protein 1 | Regulated Protein | [9] | |||
| Repulsive guidance molecule A | Regulated Protein | [10] | |||
| Secreted frizzled-related protein 1 | Regulated Protein | [10] | |||
| Septin-7 | Regulated Protein | [11] | |||
| Serpin B9 | Regulated Protein | [10] | |||
| Ski oncogene | Regulated Protein | [10] | |||
| X-box-binding protein 1 | Regulated Protein | [9] | |||
| ZW10 interactor | Regulated Protein | [10] | |||
| References | |||||
| REF 1 | Pulmonary microRNA expression profiling in an immature piglet model of cardiopulmonary bypass-induced acute lung injury. Artif Organs. 2015 Apr;39(4):327-35. | ||||
| REF 2 | A feedback inhibition between miRNA-127 and TGF/c-Jun cascade in HCC cell migration via MMP13. PLoS One. 2013 Jun 7;8(6):e65256. | ||||
| REF 3 | miRNA array screening reveals cooperative MGMT-regulation between miR-181d-5p and miR-409-3p in glioblastoma. Oncotarget. 2016 May 10;7(19):28195-206. | ||||
| REF 4 | Down-regulation of MiR-127 facilitates hepatocyte proliferation during rat liver regeneration. PLoS One. 2012;7(6):e39151. | ||||
| REF 5 | CpG island hypermethylation of tumor suppressor microRNAs in human cancer.Cell Cycle. 2007 Jun 15;6(12):1455-9. | ||||
| REF 6 | MicroRNA-127-3p acts as a tumor suppressor in epithelial ovarian cancer by regulating the BAG5 gene.Oncol Rep. 2016 Nov;36(5):2563-2570. | ||||
| REF 7 | MiroRNA-127-3p targets XRCC3 to enhance the chemosensitivity of esophageal cancer cells to a novel phenanthroline-dione derivative.Int J Biochem Cell Biol. 2016 Oct;79:158-167. | ||||
| REF 8 | The Tumor Suppressor Roles of miR-433 and miR-127 in Gastric Cancer.Int J Mol Sci. 2013 Jul 8;14(7):14171-84. | ||||
| REF 9 | B-cell differentiation in EBV-positive Burkitt lymphoma is impaired at posttranscriptional level by miRNA-altered expression.Int J Cancer. 2010 Mar 15;126(6):1316-26. | ||||
| REF 10 | Next generation sequencing analysis of miRNAs: MiR-127-3p inhibits glioblastoma proliferation and activates TGF- signaling by targeting SKI.OMICS. 2014 Mar;18(3):196-206. | ||||
| REF 11 | MicroRNA-127-3p promotes glioblastoma cell migration and invasion by targeting the tumor-suppressor gene SEPT7.Oncol Rep. 2014 May;31(5):2261-9. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.