miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-128-1-5p | ||||
| miRNA Stemloop AC | MI0000447 | ||||
| miRNA Stemloop ID | hsa-mir-128-1 | ||||
| Sequence | cggggccguagcacugucugaga | ||||
| TTD Target(s) Regulated by This miRNA | Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Protein Wnt-3a | Regulated Protein | [2] | ||
| Zinc finger protein SNAI1 | Regulated Protein | [2] | |||
| References | |||||
| REF 1 | miR128-1 inhibits the growth of glioblastoma multiforme and glioma stem-like cells via targeting BMI1 and E2F3. Oncotarget. 2016 Nov 29;7(48):78813-78826. | ||||
| REF 2 | AurkA controls self-renewal of breast cancer-initiating cells promoting wnt3a stabilization through suppression of miR-128.Sci Rep. 2016 Jun 24;6:28436. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.