miRNA General Information
miRNA Mature ID	hsa-miR-1285-3p
miRNA Stemloop AC	MI0006346 | MI0006347
miRNA Stemloop ID	hsa-mir-1285-1 | hsa-mir-1285-2
Sequence	ucugggcaacaaagugagaccu
TTD Target(s) Regulated by This miRNA	Cellular tumor antigen p53 (TP53)	Clinical trial Target	Target Info	[1]
References
REF 1	MicroRNA 125a and its regulation of the p53 tumor suppressor gene. FEBS Lett. 2009 Nov 19;583(22):3725-30.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.