miRNA General Information
miRNA Mature ID	hsa-miR-129-5p
miRNA Stemloop AC	MI0000252 | MI0000473
miRNA Stemloop ID	hsa-mir-129-1 | hsa-mir-129-2
Sequence	cuuuuugcggucugggcuugc
TTD Target(s) Regulated by This miRNA	Cyclin-dependent kinase 6 (CDK6)	Successful Target	Target Info	[1]
Protein(s) Regulated by This miRNA	Adenomatous polyposis coli protein	Regulated Protein	APC_HUMAN	[2]
	Calmodulin-binding transcription activator 1	Regulated Protein	CMTA1_HUMAN	[3]
	Collagen alpha-1(I) chain	Regulated Protein	CO1A1_HUMAN	[4]
	Fibronectin type-III domain-containing protein 3A	Regulated Protein	FND3A_HUMAN	[5]
	Insulin-like growth factor 2 mRNA-binding protein 3	Regulated Protein	IF2B3_HUMAN	[6]
	Microspherule protein 1	Regulated Protein	MCRS1_HUMAN	[7]
	Multidrug resistance-associated protein 5	Regulated Protein	MRP5_HUMAN	[8]
	NEDD8-conjugating enzyme UBE2F	Regulated Protein	UBE2F_HUMAN	[9]
	Polypeptide N-acetylgalactosaminyltransferase 1	Regulated Protein	GALT1_HUMAN	[10]
	Protein argonaute-3	Regulated Protein	AGO3_HUMAN	[3]
	Protein Wnt-4	Regulated Protein	WNT4_HUMAN	[11]
	Synaptic functional regulator FMR1	Regulated Protein	FMR1_HUMAN	[12]
	Transcription factor ETV6	Regulated Protein	ETV6_HUMAN	[10]
	Transcription factor SOX-4	Regulated Protein	SOX4_HUMAN	[10]
	Twist-related protein 1	Regulated Protein	TWST1_HUMAN	[13]
	Vimentin	Regulated Protein	VIME_HUMAN	[7]
References
REF 1	Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
REF 2	Down-regulation of miR-129-5p inhibits growth and induces apoptosis in laryngeal squamous cell carcinoma by targeting APC.PLoS One. 2013 Oct 23;8(10):e77829.
REF 3	MicroRNAs play a role in the development of human hematopoietic stem cells. J Cell Biochem. 2008 Jun 1;104(3):805-17.
REF 4	MiR-129-5p suppresses gastric cancer cell invasion and proliferation by inhibiting COL1A1.Biochem Cell Biol. 2018 Feb;96(1):19-25.
REF 5	Potential mechanisms of microRNA-129-5p in inhibiting cell processes including viability, proliferation, migration and invasiveness of glioblastoma cells U87 through targeting FNDC3B.Biomed Pharmacother. 2017 Mar;87:405-411.
REF 6	MicroRNA-129-1 acts as tumour suppressor and induces cell cycle arrest of GBM cancer cells through targeting IGF2BP3 and MAPK1.J Med Genet. 2016 Jan;53(1):24-33.
REF 7	miRNA-129-5p suppresses cell proliferation and invasion in lung cancer by targeting microspherule protein 1, E-cadherin and vimentin.Oncol Lett. 2016 Dec;12(6):5163-5169.
REF 8	Methylation of miR-129-5p CpG island modulates multi-drug resistance in gastric cancer by targeting ABC transporters.Oncotarget. 2014 Nov 30;5(22):11552-63.
REF 9	Epigenetic repression of microRNA-129-2 leads to overexpression of SOX4 oncogene in endometrial cancer.Cancer Res. 2009 Dec 1;69(23):9038-46.
REF 10	Genomic profiling of microRNAs in bladder cancer: miR-129 is associated with poor outcome and promotes cell death in vitro.Cancer Res. 2009 Jun 1;69(11):4851-60.
REF 11	Dysregulation of the BRCA1/long non-coding RNA NEAT1 signaling axis contributes to breast tumorigenesis.Oncotarget. 2016 Oct 4;7(40):65067-65089.
REF 12	The 3' UTR of FMR1 mRNA is a target of miR-101, miR-129-5p and miR-221: implications for the molecular pathology of FXTAS at the synapse.Hum Mol Genet. 2013 May 15;22(10):1971-82.
REF 13	Down-regulation of miR-129-5p via the Twist1-Snail feedback loop stimulates the epithelial-mesenchymal transition and is associated with poor prognosis in breast cancer.Oncotarget. 2015 Oct 27;6(33):34423-36.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.