miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-1296-5p | ||||
| miRNA Stemloop AC | MI0003780 | ||||
| miRNA Stemloop ID | hsa-mir-1296 | ||||
| Sequence | uuagggcccuggcuccaucucc | ||||
| TTD Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | DNA replication licensing factor MCM2 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | miR 1296-5p Inhibits the Migration and Invasion of Gastric Cancer Cells by Repressing ERBB2 Expression. PLoS One. 2017 Jan 18;12(1):e0170298. | ||||
| REF 2 | Regulation of minichromosome maintenance gene family by microRNA-1296 and genistein in prostate cancer.Cancer Res. 2010 Apr 1;70(7):2809-18. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.