miRNA General Information
miRNA Mature ID	hsa-miR-1298-5p
miRNA Stemloop AC	MI0003938
miRNA Stemloop ID	hsa-mir-1298
Sequence	uucauucggcuguccagaugua
TTD Target(s) Regulated by This miRNA	Gap junction alpha-1 protein (GJA1)	Clinical trial Target	Target Info	[1]
References
REF 1	MicroRNA-1298 is regulated by DNA methylation and affects vascular smooth muscle cell function by targeting connexin 43. Cardiovasc Res. 2015 Sep 1;107(4):534-45.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.