miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-1323 | ||||
| miRNA Stemloop AC | MI0003786 | ||||
| miRNA Stemloop ID | hsa-mir-1323 | ||||
| Sequence | ucaaaacugaggggcauuuucu | ||||
| TTD Target(s) Regulated by This miRNA | Heat shock protein 90 alpha (HSP90A) | Successful Target | Target Info | [1] | |
| Epithelial cadherin (CDH1) | Literature-reported Target | Target Info | [1] | ||
| References | |||||
| REF 1 | Genome-wide analyses of radioresistance-associated miRNA expression profile in nasopharyngeal carcinoma using next generation deep sequencing. PLoS One. 2013 Dec 19;8(12):e84486. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.