miRNA General Information
miRNA Mature ID	hsa-miR-133a-3p
miRNA Stemloop AC	MI0000450 | MI0000451
miRNA Stemloop ID	hsa-mir-133a-1 | hsa-mir-133a-2
Sequence	uuugguccccuucaaccagcug
TTD Target(s) Regulated by This miRNA	Voltage-gated potassium channel Kv11.1 (KCNH2)	Successful Target	Target Info	[1]
	Voltage-gated potassium channel Kv7.1 (KCNQ1)	Successful Target	Target Info	[2]
	Caspase-9 (CASP9)	Clinical trial Target	Target Info	[3]
	Fascin (FSCN1)	Clinical trial Target	Target Info	[4]
	Transforming protein RhoA (RHOA)	Discontinued Target	Target Info	[5]
	Hyperpolarization cyclic nucleotide-gated channel 2 (HCN2)	Literature-reported Target	Target Info	[6]
Protein(s) Regulated by This miRNA	Actin-related protein 2/3 complex subunit 5	Regulated Protein	ARPC5_HUMAN	[7]
	Aftiphilin	Regulated Protein	AFTIN_HUMAN	[8]
	Cell division control protein 42 homolog	Regulated Protein	CDC42_HUMAN	[9]
	Collagen alpha-1(I) chain	Regulated Protein	CO1A1_HUMAN	[10]
	E3 ubiquitin-protein ligase rififylin	Regulated Protein	RFFL_HUMAN	[11]
	Ferritin light chain	Regulated Protein	FRIL_HUMAN	[12]
	Forkhead box protein L2	Regulated Protein	FOXL2_HUMAN	[13]
	Keratin, type II cytoskeletal 7	Regulated Protein	K2C7_HUMAN	[14]
	LIM and SH3 domain protein 1	Regulated Protein	LASP1_HUMAN	[15]
	Low density lipoprotein receptor adapter protein 1	Regulated Protein	ARH_HUMAN	[16]
	Moesin	Regulated Protein	MOES_HUMAN	[17]
	Nuclear receptor subfamily 2 group C member 2	Regulated Protein	NR2C2_HUMAN	[18]
	PDZ and LIM domain protein 5	Regulated Protein	PDLI5_HUMAN	[19]
	Phosphatidylcholine:ceramide cholinephosphotransferase 2	Regulated Protein	SMS2_HUMAN	[20]
	Phosphatidylinositol 3-kinase regulatory subunit beta	Regulated Protein	P85B_HUMAN	[21]
	PR domain zinc finger protein 16	Regulated Protein	PRD16_HUMAN	[22]
	PR domain zinc finger protein 16	Regulated Protein	PRD16_HUMAN	[23]
	Regulator of G-protein signaling 3	Regulated Protein	RGS3_HUMAN	[21]
	Sorting nexin-30	Regulated Protein	SNX30_HUMAN	[20]
	SUMO-activating enzyme subunit 2	Regulated Protein	SAE2_HUMAN	[20]
	Transcription factor SOX-4	Regulated Protein	SOX4_HUMAN	[24]
	Transgelin-2	Regulated Protein	TAGL2_HUMAN	[25]
	Zinc finger E-box-binding homeobox 1	Regulated Protein	ZEB1_HUMAN	[26]
References
REF 1	MicroRNA miR-133 represses HERG K+ channel expression contributing to QT prolongation in diabetic hearts. J Biol Chem. 2007 Apr 27;282(17):12363-7.
REF 2	Transcriptional activation by stimulating protein 1 and post-transcriptional repression by muscle-specific microRNAs of IKs-encoding genes and pote... J Cell Physiol. 2007 Aug;212(2):358-67.
REF 3	The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, HSP70 and caspase-9 in cardiomyocytes. J Cell Sci. 2007 Sep 1;120(Pt 17):3045-52.
REF 4	miR-145 and miR-133a function as tumour suppressors and directly regulate FSCN1 expression in bladder cancer. Br J Cancer. 2010 Mar 2;102(5):883-91.
REF 5	MicroRNA-155 is regulated by the transforming growth factor beta/Smad pathway and contributes to epithelial cell plasticity by targeting RhoA. Mol Cell Biol. 2008 Nov;28(22):6773-84.
REF 6	Down-regulation of miR-1/miR-133 contributes to re-expression of pacemaker channel genes HCN2 and HCN4 in hypertrophic heart. J Biol Chem. 2008 Jul 18;283(29):20045-52.
REF 7	Actin-related protein 2/3 complex subunit 5 (ARPC5) contributes to cell migration and invasion and is directly regulated by tumor-suppressive microRNA-133a in head and neck squamous cell carcinoma.Int J Oncol. 2012 Jun;40(6):1770-8.
REF 8	Neurotensin--regulated miR-133 is involved in proinflammatory signalling in human colonic epithelial cells and in experimental colitis.Gut. 2015 Jul;64(7):1095-104.
REF 9	miR-133 is a key negative regulator of CDC42-PAK pathway in gastric cancer.Cell Signal. 2014 Dec;26(12):2667-73.
REF 10	MiR-133a regulates collagen 1A1: potential role of miR-133a in myocardial fibrosis in angiotensin II-dependent hypertension.J Cell Physiol. 2012 Feb;227(2):850-6.
REF 11	Tumor suppressor functions of miR-133a in colorectal cancer.Mol Cancer Res. 2013 Sep;11(9):1051-60.
REF 12	Iron metabolism disturbances in the MCF-7 human breast cancer cells with acquired resistance to doxorubicin and cisplatin.Int J Oncol. 2013 Nov;43(5):1481-6.
REF 13	microRNA133a targets Foxl2 and promotes differentiation of C2C12 into myogenic progenitor cells.DNA Cell Biol. 2015 Jan;34(1):29-36.
REF 14	Identification of novel microRNA targets based on microRNA signatures in bladder cancer.Int J Cancer. 2009 Jul 15;125(2):345-52.
REF 15	Functional role of LASP1 in cell viability and its regulation by microRNAs in bladder cancer.Urol Oncol. 2012 Jul-Aug;30(4):434-43.
REF 16	Induction of MiR133a expression by IL-19 targets LDLRAP1 and reduces oxLDL uptake in VSMC.J Mol Cell Cardiol. 2017 Apr;105:38-48.
REF 17	Tumor suppressive microRNA-133a regulates novel targets: moesin contributes to cancer cell proliferation and invasion in head and neck squamous cell carcinoma.Biochem Biophys Res Commun. 2012 Feb 10;418(2):378-83.
REF 18	miRNA-133a attenuates lipid accumulation via TR4-CD36 pathway in macrophages.Biochimie. 2016 Aug;127:79-85.
REF 19	miR-133a represses tumour growth and metastasis in colorectal cancer by targeting LIM and SH3 protein 1 and inhibiting the MAPK pathway.Eur J Cancer. 2013 Dec;49(18):3924-35.
REF 20	Clinical relevance and therapeutic significance of microRNA-133a expression profiles and functions in malignant osteosarcoma-initiating cells.Stem Cells. 2014 Apr;32(4):959-73.
REF 21	Endothelial-specific intron-derived miR-126 is down-regulated in human breast cancer and targets both VEGFA and PIK3R2. Mol Cell Biochem. 2011 May;351(1-2):157-64.
REF 22	MicroRNA-133 controls brown adipose determination in skeletal muscle satellite cells by targeting Prdm16.Cell Metab. 2013 Feb 5;17(2):210-24.
REF 23	miR-133a regulates adipocyte browning in vivo.PLoS Genet. 2013;9(7):e1003626.
REF 24	MiR-133a suppresses the migration and invasion of esophageal cancer cells by targeting the EMT regulator SOX4. Am J Transl Res. 2015 Aug 15;7(8):1390-403.
REF 25	The tumour-suppressive function of miR-1 and miR-133a targeting TAGLN2 in bladder cancer.Br J Cancer. 2011 Mar 1;104(5):808-18.
REF 26	Neurotensin-induced miR-133 expression regulates neurotensin receptor 1 recycling through its downstream target aftiphilin.Sci Rep. 2016 Feb 23;6:22195.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.