miRNA General Information
miRNA Mature ID	hsa-miR-134-5p
miRNA Stemloop AC	MI0000474
miRNA Stemloop ID	hsa-mir-134
Sequence	ugugacugguugaccagagggg
TTD Target(s) Regulated by This miRNA	Erbb2 tyrosine kinase receptor (HER2)	Successful Target	Target Info	[1]
	Multidrug resistance-associated protein 1 (ABCC1)	Successful Target	Target Info	[2]
	Opioid receptor mu (MOP)	Successful Target	Target Info	[3]
	Vascular endothelial growth factor A (VEGFA)	Successful Target	Target Info	[4]
	Integrin beta-1 (ITGB1)	Clinical trial Target	Target Info	[5]
	PAK-2 protein kinase (PAK2)	Literature-reported Target	Target Info	[6]
	Angiopoietin-related protein 4 (ANGPTL4)	Literature-reported Target	Target Info	[7]
	Forkhead box protein M1 (FOXM1)	Literature-reported Target	Target Info	[8]
Protein(s) Regulated by This miRNA	Golgi phosphoprotein 3	Regulated Protein	GOLP3_HUMAN	[9]
	Homeobox protein NANOG	Regulated Protein	NANOG_HUMAN	[10]
	Membrane-associated guanylate kinase, WW and PDZ domain-containing protein 2	Regulated Protein	MAGI2_HUMAN	[11]
	Palmitoyltransferase ZDHHC9	Regulated Protein	ZDHC9_HUMAN	[12]
	Pumilio homolog 2	Regulated Protein	PUM2_HUMAN	[13]
	Ras-related protein Rab-27A	Regulated Protein	RB27A_HUMAN	[14]
	Signal transducer and activator of transcription 5B	Regulated Protein	STA5B_HUMAN	[15]
	Vimentin	Regulated Protein	VIME_HUMAN	[16]
References
REF 1	High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth. Mol Oncol. 2014 Feb;8(1):93-104.
REF 2	Gene expression profiling of drug-resistant small cell lung cancer cells by combining microRNA and cDNA expression analysis. Eur J Cancer. 2010 Jun;46(9):1692-702.
REF 3	Regulation of -opioid type 1 receptors by microRNA134 in dorsal root ganglion neurons following peripheral inflammation. Eur J Pain. 2013 Mar;17(3):313-23.
REF 4	The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 5	Genome-wide screening identified that miR-134 acts as a metastasis suppressor by targeting integrin 1 in hepatocellular carcinoma. PLoS One. 2014 Feb 3;9(2):e87665.
REF 6	Down-regulated expression of miR-134 contributes to paclitaxel resistance in human ovarian cancer cells. FEBS Lett. 2015 Oct 7;589(20 Pt B):3154-64.
REF 7	MicroRNA-134 actives lipoprotein lipase-mediated lipid accumulation and inflammatory response by targeting angiopoietin-like 4 in THP-1 macrophages. Biochem Biophys Res Commun. 2016 Apr 8;472(3):410-7.
REF 8	miR-134 inhibits epithelial to mesenchymal transition by targeting FOXM1 in non-small cell lung cancer cells. FEBS Lett. 2012 Oct 19;586(20):3761-5.
REF 9	MicroRNA-134 suppresses cell proliferation in gastric cancer cells via targeting of GOLPH3.Oncol Rep. 2017 Apr;37(4):2441-2448.
REF 10	MiR-134 regulates the proliferation and invasion of glioblastoma cells by reducing Nanog expression.Int J Oncol. 2013 May;42(5):1533-40.
REF 11	MiR-134/487b/655 cluster regulates TGF--induced epithelial-mesenchymal transition and drug resistance to gefitinib by targeting MAGI2 in lung adenocarcinoma cells.Mol Cancer Ther. 2014 Feb;13(2):444-53.
REF 12	MicroRNA-134 activity in somatostatin interneurons regulates H-Ras localization by repressing the palmitoylation enzyme, DHHC9.Proc Natl Acad Sci U S A. 2013 Oct 29;110(44):17898-903.
REF 13	MiR-134-dependent regulation of Pumilio-2 is necessary for homeostatic synaptic depression.EMBO J. 2014 Oct 1;33(19):2231-46.
REF 14	MicroRNA-134-3p is a novel potential inhibitor of human ovarian cancer stem cells by targeting RAB27A.Gene. 2017 Mar 20;605:99-107.
REF 15	Multiple receptor tyrosine kinases converge on microRNA-134 to control KRAS, STAT5B, and glioblastoma.Cell Death Differ. 2014 May;21(5):720-34.
REF 16	Hybrid-polymerase chain reaction to identify novel target genes of miR-134 in paclitaxel resistant human ovarian carcinoma cells. Oncol Lett. 2015 Jun;9(6):2910-2916.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.