miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-139-5p | ||||
| miRNA Stemloop AC | MI0000261 | ||||
| miRNA Stemloop ID | hsa-mir-139 | ||||
| Sequence | ucuacagugcacgugucuccagu | ||||
| TTD Target(s) Regulated by This miRNA | Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [1] | |
| PI3-kinase alpha (PIK3CA) | Successful Target | Target Info | [2] | ||
| Proto-oncogene c-Met (MET) | Successful Target | Target Info | [3] | ||
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [4] | ||
| C-X-C chemokine receptor type 4 (CXCR4) | Successful Target | Target Info | [5] | ||
| Phosphodiesterase 4D (PDE4D) | Successful Target | Target Info | [6] | ||
| Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) | Clinical trial Target | Target Info | [7] | ||
| Rho-associated protein kinase 2 (ROCK2) | Successful Target | Target Info | [8] | ||
| DNA-binding factor KBF1 (p105) | Clinical trial Target | Target Info | [2] | ||
| Notch-1 receptor (NOTCH1) | Clinical trial Target | Target Info | [9] | ||
| Transcription factor AP-1 (JUN) | Discontinued Target | Target Info | [10] | ||
| Matrix metalloproteinase-11 (MMP-11) | Literature-reported Target | Target Info | [11] | ||
| Mitotic growth and transcription activator (BAF190A) | Literature-reported Target | Target Info | [12] | ||
| GTPase HRas (HRAS) | Literature-reported Target | Target Info | [2] | ||
| Liver receptor homolog-1 (NR5A2) | Literature-reported Target | Target Info | [13] | ||
| Proto-oncogene c-Fos (c-Fos) | Literature-reported Target | Target Info | [14] | ||
| Protein(s) Regulated by This miRNA | Actin, alpha cardiac muscle 1 | Regulated Protein | [15] | ||
| Adhesion G protein-coupled receptor L4 | Regulated Protein | [16] | |||
| Mitochondrial Rho GTPase 1 | Regulated Protein | [2] | |||
| Protein FAM162A | Regulated Protein | [18] | |||
| Protein Mis18-beta | Regulated Protein | [19] | |||
| Proto-oncogene Wnt-1 | Regulated Protein | [20] | |||
| Ras-related protein Rap-1b | Regulated Protein | [8] | |||
| Tumor protein D52 | Regulated Protein | [22] | |||
| Zinc fingers and homeoboxes protein 2 | Regulated Protein | [2] | |||
| References | |||||
| REF 1 | MiR-139 inhibits invasion and metastasis of colorectal cancer by targeting the type I insulin-like growth factor receptor. Biochem Pharmacol. 2012 Aug 1;84(3):320-30. | ||||
| REF 2 | miR-139-5p is a regulator of metastatic pathways in breast cancer. RNA. 2013 Dec;19(12):1767-80. | ||||
| REF 3 | Hsa-miR-139-5p inhibits proliferation and causes apoptosis associated with down-regulation of c-Met. Oncotarget. 2015 Nov 24;6(37):39756-92. | ||||
| REF 4 | miR-139-5p Inhibits the Epithelial-Mesenchymal Transition and Enhances the Chemotherapeutic Sensitivity of Colorectal Cancer Cells by Downregulating BCL2. Sci Rep. 2016 May 31;6:27157. | ||||
| REF 5 | HER2 interacts with CD44 to up-regulate CXCR4 via epigenetic silencing of microRNA-139 in gastric cancer cells. Gastroenterology. 2011 Dec;141(6):2076-2087.e6. | ||||
| REF 6 | Inactivation of oncogenic cAMP-specific phosphodiesterase 4D by miR-139-5p in response to p53 activation. Elife. 2016 Jul 7;5. pii: e15978. | ||||
| REF 7 | MiR-139 inhibits Mcl-1 expression and potentiates TMZ-induced apoptosis in glioma. CNS Neurosci Ther. 2013 Jul;19(7):477-83. | ||||
| REF 8 | Post-transcriptional regulation of the tumor suppressor miR-139-5p and a network of miR-139-5p-mediated mRNA interactions in colorectal cancer. FEBS J. 2014 Aug;281(16):3609-24. | ||||
| REF 9 | microRNA-139-5p exerts tumor suppressor function by targeting NOTCH1 in colorectal cancer. Mol Cancer. 2014 May 26;13:124. | ||||
| REF 10 | Involvement of aberrant miR-139/Jun feedback loop in human gastric cancer. Biochim Biophys Acta. 2015 Feb;1853(2):481-8. | ||||
| REF 11 | Dual tumor-suppressors miR-139-5p and miR-139-3p targeting matrix metalloprotease 11 in bladder cancer. Cancer Sci. 2016 Sep;107(9):1233-42. | ||||
| REF 12 | MicroRNA-139-5p regulates proliferation of hematopoietic progenitors and is repressed during BCR-ABL-mediated leukemogenesis. Blood. 2016 Oct 27;128(17):2117-2129. | ||||
| REF 13 | Tumor-suppressive function of miR-139-5p in esophageal squamous cell carcinoma. PLoS One. 2013 Oct 18;8(10):e77068. | ||||
| REF 14 | Derepression of c-Fos caused by microRNA-139 down-regulation contributes to the metastasis of human hepatocellular carcinoma. Cell Biochem Funct. 2013 Jun;31(4):319-24. | ||||
| REF 15 | A gain-of-function ACTC1 3'UTR mutation that introduces a miR-139-5p target site may be associated with a dominant familial atrial septal defect.Sci Rep. 2016 May 3;6:25404. | ||||
| REF 16 | MicroRNA-139-5p acts as a tumor suppressor by targeting ELTD1 and regulating cell cycle in glioblastoma multiforme.Biochem Biophys Res Commun. 2015 Nov 13;467(2):204-10. | ||||
| REF 17 | miR-139-5p is a regulator of metastatic pathways in breast cancer. RNA. 2013 Dec;19(12):1767-80. | ||||
| REF 18 | MiR-139-5p inhibits HGTD-P and regulates neuronal apoptosis induced by hypoxia-ischemia in neonatal rats.Neurobiol Dis. 2014 Mar;63:184-93. | ||||
| REF 19 | Loss of the Opa interacting protein 5 inhibits breast cancer proliferation through miR-139-5p/NOTCH1 pathway.Gene. 2017 Mar 1;603:1-8. | ||||
| REF 20 | MicroRNA-139-5p regulates C2C12 cell myogenesis through blocking Wnt/-catenin signaling pathway.Biochem Cell Biol. 2015 Feb;93(1):8-15. | ||||
| REF 21 | Post-transcriptional regulation of the tumor suppressor miR-139-5p and a network of miR-139-5p-mediated mRNA interactions in colorectal cancer. FEBS J. 2014 Aug;281(16):3609-24. | ||||
| REF 22 | miR-139-5p regulates proliferation, apoptosis, and cell cycle of uterine leiomyoma cells by targeting TPD52. Onco Targets Ther. 2016 Oct 11;9:6151-6160. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.