miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-140-5p | ||||
| miRNA Stemloop AC | MI0000456 | ||||
| miRNA Stemloop ID | hsa-mir-140 | ||||
| Sequence | cagugguuuuacccuaugguag | ||||
| TTD Target(s) Regulated by This miRNA | Platelet-derived growth factor receptor alpha (PDGFRA) | Successful Target | Target Info | [1] | |
| Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [2] | ||
| Adenosine deaminase (ADA) | Successful Target | Target Info | [3] | ||
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [4] | ||
| Matrix metalloproteinase-13 (MMP-13) | Clinical trial Target | Target Info | [5] | ||
| Histone deacetylase 4 (HDAC4) | Clinical trial Target | Target Info | [6] | ||
| TGF-beta receptor type I (TGFBR1) | Clinical trial Target | Target Info | [7] | ||
| DNA [cytosine-5]-methyltransferase 1 (DNMT1) | Clinical trial Target | Target Info | [8] | ||
| Rotamase Pin1 (PIN1) | Clinical trial Target | Target Info | [9] | ||
| Aspartyl aminopeptidase (DNPEP) | Clinical trial Target | Target Info | [10] | ||
| Signal transducer and activator of transcription 1 (STAT1) | Patented-recorded Target | Target Info | [11] | ||
| Histone deacetylase 7 (HDAC7) | Patented-recorded Target | Target Info | [3] | ||
| Galactocerebrosidase (GALC) | Clinical trial Target | Target Info | [12] | ||
| Transcription factor SOX-2 (SOX2) | Literature-reported Target | Target Info | [13] | ||
| Protein(s) Regulated by This miRNA | 28S ribosomal protein S10, mitochondrial | Regulated Protein | [14] | ||
| Calcium/calmodulin-dependent protein kinase II inhibitor 1 | Regulated Protein | [14] | |||
| Disintegrin and metalloproteinase domain-containing protein 9 | Regulated Protein | [15] | |||
| E3 ubiquitin-protein ligase SMURF1 | Regulated Protein | [16] | |||
| Fibroblast growth factor 9 | Regulated Protein | [7] | |||
| Fibroblast growth factor receptor-like 1 | Regulated Protein | [18] | |||
| Frizzled-6 | Regulated Protein | [12] | |||
| High mobility group nucleosome-binding domain-containing protein 5 | Regulated Protein | [20] | |||
| KATNB1-like protein 1 | Regulated Protein | [14] | |||
| Laminin subunit gamma-1 | Regulated Protein | [3] | |||
| Monocyte to macrophage differentiation factor | Regulated Protein | [22] | |||
| Osteopetrosis-associated transmembrane protein 1 | Regulated Protein | [23] | |||
| Paired box protein Pax-6 | Regulated Protein | [3] | |||
| Phosphatase and actin regulator 2 | Regulated Protein | [14] | |||
| Polypeptide N-acetylgalactosaminyltransferase 16 | Regulated Protein | [12] | |||
| PR domain zinc finger protein 1 | Regulated Protein | [14] | |||
| Ras-related protein Ral-A | Regulated Protein | [24] | |||
| Retinal dehydrogenase 1 | Regulated Protein | [25] | |||
| Septin-2 | Regulated Protein | [26] | |||
| Serine/threonine-protein kinase RIO3 | Regulated Protein | [14] | |||
| Sorting nexin-16 | Regulated Protein | [14] | |||
| STE20-related kinase adapter protein beta | Regulated Protein | [14] | |||
| Transcription factor SOX-4 | Regulated Protein | [27] | |||
| Transcription factor SOX-9 | Regulated Protein | [25] | |||
| Unconventional myosin-VI | Regulated Protein | [14] | |||
| References | |||||
| REF 1 | Biological and epidemiological evidence of interaction of infant genotypes at Rs7205289 and maternal passive smoking in cleft palate. Am J Med Genet A. 2011 Dec;155A(12):2940-8. | ||||
| REF 2 | miR-140 suppresses tumor growth and metastasis of non-small cell lung cancer by targeting insulin-like growth factor 1 receptor. PLoS One. 2013 Sep 10;8(9):e73604. | ||||
| REF 3 | Reciprocal effects between microRNA-140-5p and ADAM10 suppress migration and invasion of human tongue cancer cells. Biochem Biophys Res Commun. 2014 Jun 6;448(3):308-14. | ||||
| REF 4 | The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719. | ||||
| REF 5 | Regulation of the IGFBP-5 and MMP-13 genes by the microRNAs miR-140 and miR-27a in human osteoarthritic chondrocytes. BMC Musculoskelet Disord. 2009 Nov 30;10:148. | ||||
| REF 6 | Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem. 2008 Nov 28;283(48):33394-405. | ||||
| REF 7 | MicroRNA-140-5p suppresses tumor growth and metastasis by targeting transforming growth factor receptor 1 and fibroblast growth factor 9 in hepatocellular carcinoma. Hepatology. 2013 Jul;58(1):205-17. | ||||
| REF 8 | MicroRNA-140 acts as a liver tumor suppressor by controlling NF-B activity by directly targeting DNA methyltransferase 1 (Dnmt1) expression. Hepatology. 2013 Jan;57(1):162-70. | ||||
| REF 9 | MicroRNA-140-5p inhibits hepatocellular carcinoma by directly targeting the unique isomerase Pin1 to block multiple cancer-driving pathways. Sci Rep. 2017 Apr 6;7:45915. | ||||
| REF 10 | Chondrocyte-specific microRNA-140 regulates endochondral bone development and targets Dnpep to modulate bone morphogenetic protein signaling. Mol Cell Biol. 2011 Jul;31(14):3019-28. | ||||
| REF 11 | Inverse correlation of expression of microRNA-140-5p with progression of multiple sclerosis and differentiation of encephalitogenic T helper type 1 cells. Immunology. 2016 Apr;147(4):488-98. | ||||
| REF 12 | Genome-Wide MicroRNA and Gene Analysis of Mesenchymal Stem Cell Chondrogenesis Identifies an Essential Role and Multiple Targets for miR-140-5p. Stem Cells. 2015 Nov;33(11):3266-80. | ||||
| REF 13 | Estrogen receptor signaling regulates breast tumor-initiating cells by down-regulating miR-140 which targets the transcription factor SOX2. J Biol Chem. 2012 Nov 30;287(49):41514-22. | ||||
| REF 14 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
| REF 15 | MicroRNA-140 represses glioma growth and metastasis by directly targeting ADAM9.Oncol Rep. 2016 Oct;36(4):2329-38. | ||||
| REF 16 | MicroRNA-140-5p and SMURF1 regulate pulmonary arterial hypertension.J Clin Invest. 2016 Jul 1;126(7):2495-508. | ||||
| REF 17 | MicroRNA-140-5p suppresses tumor growth and metastasis by targeting transforming growth factor receptor 1 and fibroblast growth factor 9 in hepatocellular carcinoma. Hepatology. 2013 Jul;58(1):205-17. | ||||
| REF 18 | Identification of a novel FGFRL1 MicroRNA target site polymorphism for bone mineral density in meta-analyses of genome-wide association studies.Hum Mol Genet. 2015 Aug 15;24(16):4710-27. | ||||
| REF 19 | Genome-Wide MicroRNA and Gene Analysis of Mesenchymal Stem Cell Chondrogenesis Identifies an Essential Role and Multiple Targets for miR-140-5p. Stem Cells. 2015 Nov;33(11):3266-80. | ||||
| REF 20 | MicroRNA-140-5p regulates osteosarcoma chemoresistance by targeting HMGN5 and autophagy.Sci Rep. 2017 Mar 24;7(1):416. | ||||
| REF 21 | Reciprocal effects between microRNA-140-5p and ADAM10 suppress migration and invasion of human tongue cancer cells. Biochem Biophys Res Commun. 2014 Jun 6;448(3):308-14. | ||||
| REF 22 | Monocyte to macrophage differentiation-associated (MMD) targeted by miR-140-5p regulates tumor growth in non-small cell lung cancer.Biochem Biophys Res Commun. 2014 Jul 18;450(1):844-50. | ||||
| REF 23 | MicroRNA-140 promotes adipocyte lineage commitment of C3H10T1/2 pluripotent stem cells via targeting osteopetrosis-associated transmembrane protein 1.J Biol Chem. 2013 Mar 22;288(12):8222-30. | ||||
| REF 24 | microRNA-140 targets RALA and regulates chondrogenic differentiation of human mesenchymal stem cells by translational enhancement of SOX9 and ACAN.Stem Cells Dev. 2014 Feb 1;23(3):290-304. | ||||
| REF 25 | Downregulation of miR-140 promotes cancer stem cell formation in basal-like early stage breast cancer.Oncogene. 2014 May 15;33(20):2589-600. | ||||
| REF 26 | Septin 2 accelerates the progression of biliary tract cancer and is negatively regulated by mir-140-5p.Gene. 2016 Sep 1;589(1):20-26. | ||||
| REF 27 | MicroRNA-140 Inhibits Cell Proliferation in Gastric Cancer Cell Line HGC-27 by Suppressing SOX4.Med Sci Monit. 2016 Jun 29;22:2243-52. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.