miRNA General Information
miRNA Mature ID hsa-miR-140-5p
miRNA Stemloop AC MI0000456
miRNA Stemloop ID hsa-mir-140
Sequence cagugguuuuacccuaugguag
TTD Target(s) Regulated by This miRNA Platelet-derived growth factor receptor alpha (PDGFRA) Successful Target Target Info [1]
Insulin-like growth factor I receptor (IGF1R) Successful Target Target Info [2]
Adenosine deaminase (ADA) Successful Target Target Info [3]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [4]
Matrix metalloproteinase-13 (MMP-13) Clinical trial Target Target Info [5]
Histone deacetylase 4 (HDAC4) Clinical trial Target Target Info [6]
TGF-beta receptor type I (TGFBR1) Clinical trial Target Target Info [7]
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Clinical trial Target Target Info [8]
Rotamase Pin1 (PIN1) Clinical trial Target Target Info [9]
Aspartyl aminopeptidase (DNPEP) Clinical trial Target Target Info [10]
Signal transducer and activator of transcription 1 (STAT1) Patented-recorded Target Target Info [11]
Histone deacetylase 7 (HDAC7) Patented-recorded Target Target Info [3]
Galactocerebrosidase (GALC) Literature-reported Target Target Info [12]
Transcription factor SOX-2 (SOX2) Literature-reported Target Target Info [13]
Protein(s) Regulated by This miRNA 28S ribosomal protein S10, mitochondrial Regulated Protein [14]
Calcium/calmodulin-dependent protein kinase II inhibitor 1 Regulated Protein [14]
Disintegrin and metalloproteinase domain-containing protein 9 Regulated Protein [15]
E3 ubiquitin-protein ligase SMURF1 Regulated Protein [16]
Fibroblast growth factor 9 Regulated Protein [7]
Fibroblast growth factor receptor-like 1 Regulated Protein [18]
Frizzled-6 Regulated Protein [12]
High mobility group nucleosome-binding domain-containing protein 5 Regulated Protein [20]
KATNB1-like protein 1 Regulated Protein [14]
Laminin subunit gamma-1 Regulated Protein [3]
Monocyte to macrophage differentiation factor Regulated Protein [22]
Osteopetrosis-associated transmembrane protein 1 Regulated Protein [23]
Paired box protein Pax-6 Regulated Protein [3]
Phosphatase and actin regulator 2 Regulated Protein [14]
Polypeptide N-acetylgalactosaminyltransferase 16 Regulated Protein [12]
PR domain zinc finger protein 1 Regulated Protein [14]
Ras-related protein Ral-A Regulated Protein [24]
Retinal dehydrogenase 1 Regulated Protein [25]
Septin-2 Regulated Protein [26]
Serine/threonine-protein kinase RIO3 Regulated Protein [14]
Sorting nexin-16 Regulated Protein [14]
STE20-related kinase adapter protein beta Regulated Protein [14]
Transcription factor SOX-4 Regulated Protein [27]
Transcription factor SOX-9 Regulated Protein [25]
Unconventional myosin-VI Regulated Protein [14]
References
REF 1 Biological and epidemiological evidence of interaction of infant genotypes at Rs7205289 and maternal passive smoking in cleft palate. Am J Med Genet A. 2011 Dec;155A(12):2940-8.
REF 2 miR-140 suppresses tumor growth and metastasis of non-small cell lung cancer by targeting insulin-like growth factor 1 receptor. PLoS One. 2013 Sep 10;8(9):e73604.
REF 3 Reciprocal effects between microRNA-140-5p and ADAM10 suppress migration and invasion of human tongue cancer cells. Biochem Biophys Res Commun. 2014 Jun 6;448(3):308-14.
REF 4 The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 5 Regulation of the IGFBP-5 and MMP-13 genes by the microRNAs miR-140 and miR-27a in human osteoarthritic chondrocytes. BMC Musculoskelet Disord. 2009 Nov 30;10:148.
REF 6 Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem. 2008 Nov 28;283(48):33394-405.
REF 7 MicroRNA-140-5p suppresses tumor growth and metastasis by targeting transforming growth factor receptor 1 and fibroblast growth factor 9 in hepatocellular carcinoma. Hepatology. 2013 Jul;58(1):205-17.
REF 8 MicroRNA-140 acts as a liver tumor suppressor by controlling NF-B activity by directly targeting DNA methyltransferase 1 (Dnmt1) expression. Hepatology. 2013 Jan;57(1):162-70.
REF 9 MicroRNA-140-5p inhibits hepatocellular carcinoma by directly targeting the unique isomerase Pin1 to block multiple cancer-driving pathways. Sci Rep. 2017 Apr 6;7:45915.
REF 10 Chondrocyte-specific microRNA-140 regulates endochondral bone development and targets Dnpep to modulate bone morphogenetic protein signaling. Mol Cell Biol. 2011 Jul;31(14):3019-28.
REF 11 Inverse correlation of expression of microRNA-140-5p with progression of multiple sclerosis and differentiation of encephalitogenic T helper type 1 cells. Immunology. 2016 Apr;147(4):488-98.
REF 12 Genome-Wide MicroRNA and Gene Analysis of Mesenchymal Stem Cell Chondrogenesis Identifies an Essential Role and Multiple Targets for miR-140-5p. Stem Cells. 2015 Nov;33(11):3266-80.
REF 13 Estrogen receptor signaling regulates breast tumor-initiating cells by down-regulating miR-140 which targets the transcription factor SOX2. J Biol Chem. 2012 Nov 30;287(49):41514-22.
REF 14 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 15 MicroRNA-140 represses glioma growth and metastasis by directly targeting ADAM9.Oncol Rep. 2016 Oct;36(4):2329-38.
REF 16 MicroRNA-140-5p and SMURF1 regulate pulmonary arterial hypertension.J Clin Invest. 2016 Jul 1;126(7):2495-508.
REF 17 MicroRNA-140-5p suppresses tumor growth and metastasis by targeting transforming growth factor receptor 1 and fibroblast growth factor 9 in hepatocellular carcinoma. Hepatology. 2013 Jul;58(1):205-17.
REF 18 Identification of a novel FGFRL1 MicroRNA target site polymorphism for bone mineral density in meta-analyses of genome-wide association studies.Hum Mol Genet. 2015 Aug 15;24(16):4710-27.
REF 19 Genome-Wide MicroRNA and Gene Analysis of Mesenchymal Stem Cell Chondrogenesis Identifies an Essential Role and Multiple Targets for miR-140-5p. Stem Cells. 2015 Nov;33(11):3266-80.
REF 20 MicroRNA-140-5p regulates osteosarcoma chemoresistance by targeting HMGN5 and autophagy.Sci Rep. 2017 Mar 24;7(1):416.
REF 21 Reciprocal effects between microRNA-140-5p and ADAM10 suppress migration and invasion of human tongue cancer cells. Biochem Biophys Res Commun. 2014 Jun 6;448(3):308-14.
REF 22 Monocyte to macrophage differentiation-associated (MMD) targeted by miR-140-5p regulates tumor growth in non-small cell lung cancer.Biochem Biophys Res Commun. 2014 Jul 18;450(1):844-50.
REF 23 MicroRNA-140 promotes adipocyte lineage commitment of C3H10T1/2 pluripotent stem cells via targeting osteopetrosis-associated transmembrane protein 1.J Biol Chem. 2013 Mar 22;288(12):8222-30.
REF 24 microRNA-140 targets RALA and regulates chondrogenic differentiation of human mesenchymal stem cells by translational enhancement of SOX9 and ACAN.Stem Cells Dev. 2014 Feb 1;23(3):290-304.
REF 25 Downregulation of miR-140 promotes cancer stem cell formation in basal-like early stage breast cancer.Oncogene. 2014 May 15;33(20):2589-600.
REF 26 Septin 2 accelerates the progression of biliary tract cancer and is negatively regulated by mir-140-5p.Gene. 2016 Sep 1;589(1):20-26.
REF 27 MicroRNA-140 Inhibits Cell Proliferation in Gastric Cancer Cell Line HGC-27 by Suppressing SOX4.Med Sci Monit. 2016 Jun 29;22:2243-52.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.