miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-143-5p | ||||
| miRNA Stemloop AC | MI0000459 | ||||
| miRNA Stemloop ID | hsa-mir-143 | ||||
| Sequence | ggugcagugcugcaucucuggu | ||||
| TTD Target(s) Regulated by This miRNA | Erbb3 tyrosine kinase receptor (Erbb-3) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Prostaglandin G/H synthase 2 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | miR-143 and miR-145 synergistically regulate ERBB3 to suppress cell proliferation and invasion in breast cancer. Mol Cancer. 2014 Sep 24;13:220. | ||||
| REF 2 | MicroRNA-143 suppresses gastric cancer cell growth and induces apoptosis by targeting COX-2.World J Gastroenterol. 2013;19(43):7758-65. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.