miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-146a-5p
miRNA Stemloop AC MI0000477
miRNA Stemloop ID hsa-mir-146a
Sequence ugagaacugaauuccauggguu
TTD Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Successful Target Target Info [1]
Erbb4 tyrosine kinase receptor (Erbb-4) Successful Target Target Info [2]
Protein kinase C epsilon (PRKCE) Successful Target Target Info [3]
C-X-C chemokine receptor type 4 (CXCR4) Successful Target Target Info [4]
Interleukin-6 (IL6) Successful Target Target Info [5]
Interleukin-8 (IL8) Successful Target Target Info [6]
Activation B7-1 antigen (CD80) Successful Target Target Info [7]
Intercellular adhesion molecule ICAM-1 (ICAM1) Successful Target Target Info [8]
Prostaglandin G/H synthase 2 (COX-2) Successful Target Target Info [9]
Retinoic acid receptor beta (RARB) Successful Target Target Info [10]
Transforming growth factor beta 1 (TGFB1) Successful Target Target Info [11]
Urokinase plasminogen activator surface receptor (PLAUR) Successful Target Target Info [12]
Rho-associated protein kinase 1 (ROCK1) Successful Target Target Info [13]
Nitric-oxide synthase brain (NOS1) Clinical trial Target Target Info [14]
Dual specificity protein phosphatase 1 (DUSP1) Clinical trial Target Target Info [15]
Macrophage migration inhibitory factor (MIF) Clinical trial Target Target Info [16]
Toll-like receptor 4 (TLR4) Clinical trial Target Target Info [17]
Apoptosis mediating surface antigen FAS (FAS) Clinical trial Target Target Info [18]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [19]
TNF related activation protein (CD40LG) Clinical trial Target Target Info [20]
Toll-like receptor 2 (TLR2) Clinical trial Target Target Info [7]
Caspase-7 (CASP7) Clinical trial Target Target Info [21]
DNA-binding factor KBF1 (p105) Clinical trial Target Target Info [6]
Notch-1 receptor (NOTCH1) Clinical trial Target Target Info [22]
Notch-2 receptor (NOTCH2) Clinical trial Target Target Info [22]
Stromal cell-derived factor 1 (CXCL12) Clinical trial Target Target Info [23]
T-cell-specific protein RANTES (CCL5) Clinical trial Target Target Info [24]
Calgranulin D (S100A12) Clinical trial Target Target Info [25]
Complement factor H (CFH) Clinical trial Target Target Info [26]
Survival motor neuron protein (SMN1) Successful Target Target Info [27]
Signal transducer and activator of transcription 1 (STAT1) Patented-recorded Target Target Info [28]
IL-1 receptor-associated kinase 1 (IRAK1) Patented-recorded Target Target Info [29]
Transforming protein RhoA (RHOA) Discontinued Target Target Info [30]
Ras-related C3 botulinum toxin substrate 1 (RAC1) Literature-reported Target Target Info [31]
Rhodopsin (RHO) Literature-reported Target Target Info [32]
Carboxypeptidase M (CPM) Literature-reported Target Target Info [33]
Cyclin A2 (CCNA2) Literature-reported Target Target Info [34]
TNF receptor-associated factor 6 (TRAF6) Literature-reported Target Target Info [29]
Breast cancer type 2 susceptibility protein (BRCA2) Literature-reported Target Target Info [35]
Interleukin 1 receptor accessory protein (IL1RAP) Clinical trial Target Target Info [25]
LDL receptor related protein-2 (LRP-2) Literature-reported Target Target Info [36]
Proto-oncogene c-Fos (c-Fos) Literature-reported Target Target Info [37]
ELAV-like protein 1 (ELAVL1) Literature-reported Target Target Info [38]
Laminin gamma-2 subunit (LAMC2) Literature-reported Target Target Info [31]
Melanoma differentiation-associated protein 6 (CDKN1A) Literature-reported Target Target Info [39]
Osteopontin (SPP1) Literature-reported Target Target Info [40]
Transcription factor SOX-2 (SOX2) Literature-reported Target Target Info [41]
Protein(s) Regulated by This miRNA Antileukoproteinase Regulated Protein
SLPI_HUMAN
[40]
Bcl-2-associated transcription factor 1 Regulated Protein
BCLF1_HUMAN
[21]
Beta-1,3-N-acetylglucosaminyltransferase lunatic fringe Regulated Protein
LFNG_HUMAN
[44]
Breast cancer type 1 susceptibility protein Regulated Protein
BRCA1_HUMAN
[35]
Caspase recruitment domain-containing protein 10 Regulated Protein
CAR10_HUMAN
[46]
CCR4-NOT transcription complex subunit 6-like Regulated Protein
CNO6L_HUMAN
[47]
Coiled-coil domain-containing protein 6 Regulated Protein
CCDC6_HUMAN
[25]
COP9 signalosome complex subunit 8 Regulated Protein
CSN8_HUMAN
[46]
Cyclin-dependent kinase inhibitor 3 Regulated Protein
CDKN3_HUMAN
[34]
E3 ubiquitin-protein ligase UHRF1 Regulated Protein
UHRF1_HUMAN
[50]
Fanconi anemia group M protein Regulated Protein
FANCM_HUMAN
[51]
FAS-associated death domain protein Regulated Protein
FADD_HUMAN
[52]
FAS-associated factor 1 Regulated Protein
FAF1_HUMAN
[53]
G1/S-specific cyclin-D2 Regulated Protein
CCND2_HUMAN
[19]
Homeobox protein Hox-D10 Regulated Protein
HXD10_HUMAN
[55]
Interleukin-1 receptor-associated kinase-like 2 Regulated Protein
IRAK2_HUMAN
[56]
Interleukin-1 receptor-like 2 Regulated Protein
ILRL2_HUMAN
[25]
Kinesin-like protein KIF22 Regulated Protein
KIF22_HUMAN
[34]
Lysine-specific demethylase 2B Regulated Protein
KDM2B_HUMAN
[57]
Metastasis-associated protein MTA2 Regulated Protein
MTA2_HUMAN
[56]
Mothers against decapentaplegic homolog 2 Regulated Protein
SMAD2_HUMAN
[58]
Mothers against decapentaplegic homolog 4 Regulated Protein
SMAD4_HUMAN
[59]
Neural cell adhesion molecule L1 Regulated Protein
L1CAM_HUMAN
[60]
Nuclear factor of activated T-cells 5 Regulated Protein
NFAT5_HUMAN
[32]
Osteocalcin Regulated Protein
OSTCN_HUMAN
[40]
Proliferation-associated protein 2G4 Regulated Protein
PA2G4_HUMAN
[34]
Prostaglandin E synthase 2 Regulated Protein
PGES2_HUMAN
[62]
Prostaglandin G/H synthase 2 Regulated Protein
PGH2_HUMAN
[63]
Protein lin-52 homolog Regulated Protein
LIN52_HUMAN
[64]
Protein numb homolog Regulated Protein
NUMB_HUMAN
[65]
RING finger protein 11 Regulated Protein
RNF11_HUMAN
[66]
Roundabout homolog 1 Regulated Protein
ROBO1_HUMAN
[67]
Son of sevenless homolog 1 Regulated Protein
SOS1_HUMAN
[68]
Suppressor of IKBKE 1 Regulated Protein
SIKE1_HUMAN
[23]
Unconventional myosin-VI Regulated Protein
MYO6_HUMAN
[25]
Wiskott-Aldrich syndrome protein family member 2 Regulated Protein
WASF2_HUMAN
[70]
Zinc finger protein 117 Regulated Protein
ZN117_HUMAN
[25]
References
REF 1 Breast cancer metastasis suppressor 1 up-regulates miR-146, which suppresses breast cancer metastasis. Cancer Res. 2009 Feb 15;69(4):1279-83.
REF 2 MicroRNA-146a is a therapeutic target and biomarker for peripartum cardiomyopathy. J Clin Invest. 2013 May;123(5):2143-54.
REF 3 MicroRNA-146a controls Th1-cell differentiation of human CD4+ T lymphocytes by targeting PRKC. Eur J Immunol. 2015 Jan;45(1):260-72.
REF 4 A three-step pathway comprising PLZF/miR-146a/CXCR4 controls megakaryopoiesis. Nat Cell Biol. 2008 Jul;10(7):788-801.
REF 5 Dysregulation in microRNA expression in peripheral blood mononuclear cells of sepsis patients is associated with immunopathology. Cytokine. 2015 Jan;71(1):89-100.
REF 6 Expression of microRNA-146 suppresses NF-kappaB activity with reduction of metastatic potential in breast cancer cells. Oncogene. 2008 Sep 18;27(42):5643-7.
REF 7 miR-146a is differentially expressed by myeloid dendritic cell subsets and desensitizes cells to TLR2-dependent activation. J Immunol. 2010 May 1;184(9):4955-65.
REF 8 Regulation of retinal inflammation by rhythmic expression of MiR-146a in diabetic retina. Invest Ophthalmol Vis Sci. 2014 May 27;55(6):3986-94.
REF 9 MicroRNA-146a negatively regulates PTGS2 expression induced by Helicobacter pylori in human gastric epithelial cells. J Gastroenterol. 2013 Jan;48(1):86-92.
REF 10 Family of microRNA-146 Regulates RAR in Papillary Thyroid Carcinoma. PLoS One. 2016 Mar 24;11(3):e0151968.
REF 11 LPS induces HUVEC angiogenesis in vitro through miR-146a-mediated TGF-1 inhibition. Am J Transl Res. 2017 Feb 15;9(2):591-600.
REF 12 Urokinase receptor and CXCR4 are regulated by common microRNAs in leukaemia cells. J Cell Mol Med. 2015 Sep;19(9):2262-72.
REF 13 Hsa-miR-146a-5p modulates androgen-independent prostate cancer cells apoptosis by targeting ROCK1. Prostate. 2015 Dec;75(16):1896-903.
REF 14 A Variant in the Precursor of MicroRNA-146a is Responsible for Development of Erectile Dysfunction in Patients with Chronic Prostatitis via Targeting NOS1. Med Sci Monit. 2017 Feb 20;23:929-937.
REF 15 Mitogen-activated protein kinase phosphatase 1 disrupts proinflammatory protein synthesis in endotoxin-adapted monocytes. Clin Vaccine Immunol. 2013 Sep;20(9):1396-404.
REF 16 Effect and molecular mechanism of mir-146a on proliferation of lung cancer cells by targeting and regulating MIF gene. Asian Pac J Trop Med. 2016 Aug;9(8):806-11.
REF 17 MiR-146a inhibits oxidized low-density lipoprotein-induced lipid accumulation and inflammatory response via targeting toll-like receptor 4. FEBS Lett. 2011 Mar 23;585(6):854-60.
REF 18 Diazoxide potentiates mesenchymal stem cell survival via NF-kappaB-dependent miR-146a expression by targeting Fas. Am J Physiol Heart Circ Physiol. 2010 Oct;299(4):H1077-82.
REF 19 MiR-146a-5p inhibits cell proliferation and cell cycle progression in NSCLC cell lines by targeting CCND1 and CCND2. Oncotarget. 2016 Sep 13;7(37):59287-59298.
REF 20 MicroRNA-146a regulates the maturation process and pro-inflammatory cytokine secretion by targeting CD40L in oxLDL-stimulated dendritic cells. FEBS Lett. 2011 Feb 4;585(3):567-73.
REF 21 MicroRNA-146a down-regulation correlates with neuroprotection and targets pro-apoptotic genes in cerebral ischemic injury in vitro. Brain Res. 2016 Oct 1;1648(Pt A):136-143.
REF 22 A functional polymorphism in the preiR 46a gene influences the prognosis of glioblastoma multiforme by interfering with the balance between Notch1 and Notch2. Mol Med Rep. 2015 Oct;12(4):5475-81.
REF 23 miR-146a-5p circuitry uncouples cell proliferation and migration, but not differentiation, in human mesenchymal stem cells. Nucleic Acids Res. 2013 Nov;41(21):9753-63.
REF 24 MicroRNA-146a alleviates chronic skin inflammation in atopic dermatitis through suppression of innate immune responses in keratinocytes. J Allergy Clin Immunol. 2014 Oct;134(4):836-847.e11.
REF 25 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 26 An NF-kappaB-sensitive micro RNA-146a-mediated inflammatory circuit in Alzheimer disease and in stressed human brain cells. J Biol Chem. 2008 Nov 14;283(46):31315-22.
REF 27 Increased miR-146a in gastric cancer directly targets SMAD4 and is involved in modulating cell proliferation and apoptosis. Oncol Rep. 2012 Feb;27(2):559-66.
REF 28 MicroRNA-146A contributes to abnormal activation of the type I interferon pathway in human lupus by targeting the key signaling proteins. Arthritis Rheum. 2009 Apr;60(4):1065-75.
REF 29 NF-kappaB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci U S A. 2006 Aug 15;103(33):12481-6.
REF 30 MicroRNA-146a inhibits cell migration and invasion by targeting RhoA in breast cancer. Oncol Rep. 2016 Jul;36(1):189-96.
REF 31 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
REF 32 Brain endothelial miR-146a negatively modulates T-cell adhesion through repressing multiple targets to inhibit NF-B activation. J Cereb Blood Flow Metab. 2015 Mar;35(3):412-23.
REF 33 MicroRNA-146a promote cell migration and invasion in human colorectal cancer via carboxypeptidase M/src-FAK pathway. Oncotarget. 2017 Apr 4;8(14):22674-22684.
REF 34 Identification of the potential target genes of microRNA-146a induced by PMA treatment in human microvascular endothelial cells. Exp Cell Res. 2010 Apr 15;316(7):1119-26.
REF 35 A functional polymorphism in the miR-146a gene and age of familial breast/ovarian cancer diagnosis. Carcinogenesis. 2008 Oct;29(10):1963-6.
REF 36 MicroRNA-146a represses LRP2 translation and leads to cell apoptosis in Alzheimer's disease. FEBS Lett. 2016 Jul;590(14):2190-200.
REF 37 miR-146a targets Fos expression in human cardiac cells. Dis Model Mech. 2015 Sep;8(9):1081-91.
REF 38 MicroRNA-146 represses endothelial activation by inhibiting pro-inflammatory pathways. EMBO Mol Med. 2013 Jul;5(7):1017-34.
REF 39 Multiple microRNAs rescue from Ras-induced senescence by inhibiting p21(Waf1/Cip1). Oncogene. 2010 Apr 15;29(15):2262-71.
REF 40 miR-146a induces differentiation of periodontal ligament cells. J Dent Res. 2010 Mar;89(3):252-7.
REF 41 Decrease of miR-146a is associated with the aggressiveness of human oral squamous cell carcinoma. Arch Oral Biol. 2015 Sep;60(9):1416-27.
REF 42 miR-146a induces differentiation of periodontal ligament cells. J Dent Res. 2010 Mar;89(3):252-7.
REF 43 MicroRNA-146a down-regulation correlates with neuroprotection and targets pro-apoptotic genes in cerebral ischemic injury in vitro. Brain Res. 2016 Oct 1;1648(Pt A):136-143.
REF 44 miR-146a Exerts Differential Effects on Melanoma Growth and Metastatization.Mol Cancer Res. 2016 Jun;14(6):548-62.
REF 45 A functional polymorphism in the miR-146a gene and age of familial breast/ovarian cancer diagnosis. Carcinogenesis. 2008 Oct;29(10):1963-6.
REF 46 microRNA-146a inhibits G protein-coupled receptor-mediated activation of NF-B by targeting CARD10 and COPS8 in gastric cancer. Mol Cancer. 2012 Sep 20;11:71.
REF 47 Loss of Git2 induces epithelial-mesenchymal transition by miR146a-Cnot6L-controlled expression of Zeb1.J Cell Sci. 2013 Jun 15;126(Pt 12):2740-6.
REF 48 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 49 Identification of the potential target genes of microRNA-146a induced by PMA treatment in human microvascular endothelial cells. Exp Cell Res. 2010 Apr 15;316(7):1119-26.
REF 50 Regulation of UHRF1 by miR-146a/b modulates gastric cancer invasion and metastasis.FASEB J. 2013 Dec;27(12):4929-39.
REF 51 miR146a-mediated targeting of FANCM during inflammation compromises genome integrity.Oncotarget. 2016 Jul 19;7(29):45976-45994.
REF 52 An emerging player in the adaptive immune response: microRNA-146a is a modulator of IL-2 expression and activation-induced cell death in T lymphocytes.Blood. 2010 Jan 14;115(2):265-73.
REF 53 Altered microRNA expression profile with miR-146a upregulation in CD4+ T cells from patients with rheumatoid arthritis.Arthritis Res Ther. 2010;12(3):R81.
REF 54 MiR-146a-5p inhibits cell proliferation and cell cycle progression in NSCLC cell lines by targeting CCND1 and CCND2. Oncotarget. 2016 Sep 13;7(37):59287-59298.
REF 55 The roles of HOXD10 in the development and progression of head and neck squamous cell carcinoma (HNSCC).Br J Cancer. 2014 Aug 12;111(4):807-16.
REF 56 miR-146a suppresses invasion of pancreatic cancer cells. Cancer Res. 2010 Feb 15;70(4):1486-95.
REF 57 Decreased miR-146a expression in acute ischemic stroke directly targets the Fbxl10 mRNA and is involved in modulating apoptosis.Neurochem Int. 2017 Jul;107:156-167.
REF 58 MicroRNA-146a regulates human foetal femur derived skeletal stem cell differentiation by down-regulating SMAD2 and SMAD3.PLoS One. 2014 Jun 3;9(6):e98063.
REF 59 miR-146a, an IL-1 responsive miRNA, induces vascular endothelial growth factor and chondrocyte apoptosis by targeting Smad4.Arthritis Res Ther. 2012 Apr 16;14(2):R75.
REF 60 microRNA-146a targets the L1 cell adhesion molecule and suppresses the metastatic potential of gastric cancer.Mol Med Rep. 2012 Sep;6(3):501-6.
REF 61 Brain endothelial miR-146a negatively modulates T-cell adhesion through repressing multiple targets to inhibit NF-B activation. J Cereb Blood Flow Metab. 2015 Mar;35(3):412-23.
REF 62 MicroRNA-146a negatively regulates the immunoregulatory activity of bone marrow stem cells by targeting prostaglandin E2 synthase-2.J Immunol. 2013 May 15;190(10):5102-9.
REF 63 Regulation of COX-2 expression by miR-146a in lung cancer cells.RNA. 2014 Sep;20(9):1419-30.
REF 64 MicroRNA-146a affects the chemotherapeutic sensitivity and prognosis of advanced gastric cancer through the regulation of LIN52.Oncol Lett. 2017 Mar;13(3):1386-1392.
REF 65 miR-146a enhances the oncogenicity of oral carcinoma by concomitant targeting of the IRAK1, TRAF6 and NUMB genes.PLoS One. 2013 Nov 26;8(11):e79926.
REF 66 Promotion of Hendra virus replication by microRNA 146a.J Virol. 2013 Apr;87(7):3782-91.
REF 67 A common polymorphism in pre-miR-146a underlies Hirschsprung disease risk in Han Chinese.Exp Mol Pathol. 2014 Dec;97(3):511-4.
REF 68 miR-146a and miR-370 coordinate enterovirus 71-induced cell apoptosis through targeting SOS1 and GADD45.Cell Microbiol. 2015 Jun;17(6):802-18.
REF 69 miR-146a-5p circuitry uncouples cell proliferation and migration, but not differentiation, in human mesenchymal stem cells. Nucleic Acids Res. 2013 Nov;41(21):9753-63.
REF 70 MicroRNA-146a acts as a metastasis suppressor in gastric cancer by targeting WASF2.Cancer Lett. 2013 Jul 10;335(1):219-24.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.