miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-146b-5p | ||||
| miRNA Stemloop AC | MI0003129 | ||||
| miRNA Stemloop ID | hsa-mir-146b | ||||
| Sequence | ugagaacugaauuccauaggcu | ||||
| miRNA General Information | |||||
| miRNA Mature ID | hsa-miR-146b-5p | ||||
| miRNA Stemloop AC | MI0003129 | ||||
| miRNA Stemloop ID | hsa-mir-146b | ||||
| Sequence | ugagaacugaauuccauaggcug | ||||
| TTD Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Successful Target | Target Info | [1] | |
| Erbb4 tyrosine kinase receptor (Erbb-4) | Successful Target | Target Info | [2] | ||
| Platelet-derived growth factor receptor alpha (PDGFRA) | Successful Target | Target Info | [3] | ||
| Tyrosine-protein kinase Kit (KIT) | Successful Target | Target Info | [4] | ||
| Extracellular calcium-sensing receptor (CASR) | Successful Target | Target Info | [5] | ||
| Interleukin-6 (IL6) | Successful Target | Target Info | [6] | ||
| Retinoic acid receptor beta (RARB) | Successful Target | Target Info | [7] | ||
| Toll-like receptor 4 (TLR4) | Clinical trial Target | Target Info | [8] | ||
| DNA-binding factor KBF1 (p105) | Clinical trial Target | Target Info | [9] | ||
| Calgranulin D (S100A12) | Clinical trial Target | Target Info | [10] | ||
| Sodium/iodide cotransporter (SLC5A5) | Clinical trial Target | Target Info | [11] | ||
| IL-1 receptor-associated kinase 1 (IRAK1) | Patented-recorded Target | Target Info | [12] | ||
| Matrix metalloproteinase-16 (MMP-16) | Literature-reported Target | Target Info | [13] | ||
| TNF receptor-associated factor 6 (TRAF6) | Literature-reported Target | Target Info | [12] | ||
| Interleukin 1 receptor accessory protein (IL1RAP) | Clinical trial Target | Target Info | [10] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [14] | ||
| Protein(s) Regulated by This miRNA | Coiled-coil domain-containing protein 6 | Regulated Protein | [10] | ||
| E3 ubiquitin-protein ligase UHRF1 | Regulated Protein | [16] | |||
| E3 ubiquitin-protein ligase ZNRF3 | Regulated Protein | [17] | |||
| Heterogeneous nuclear ribonucleoprotein D0 | Regulated Protein | [18] | |||
| Interleukin-1 receptor-like 2 | Regulated Protein | [10] | |||
| Paired box protein Pax-8 | Regulated Protein | [19] | |||
| RNA-binding protein Nova-1 | Regulated Protein | [20] | |||
| Unconventional myosin-VI | Regulated Protein | [10] | |||
| Zinc finger protein 117 | Regulated Protein | [10] | |||
| References | |||||
| REF 1 | MicroRNA-146b-5p inhibits the growth of gallbladder carcinoma by targeting epidermal growth factor receptor. Mol Med Rep. 2015 Jul;12(1):1549-55. | ||||
| REF 2 | MicroRNA-146b, a Sensitive Indicator of Mesenchymal Stem Cell Repair of Acute Renal Injury. Stem Cells Transl Med. 2016 Oct;5(10):1406-1415. | ||||
| REF 3 | The regulatory roles of microRNA-146b-5p and its target platelet-derived growth factor receptor (PDGFRA) in erythropoiesis and megakaryocytopoiesis. J Biol Chem. 2014 Aug 15;289(33):22600-13. | ||||
| REF 4 | The role of microRNA genes in papillary thyroid carcinoma. Proc Natl Acad Sci U S A. 2005 Dec 27;102(52):19075-80. | ||||
| REF 5 | miR-135b- and miR-146b-dependent silencing of calcium-sensing receptor expression in colorectal tumors. Int J Cancer. 2016 Jan 1;138(1):137-45. | ||||
| REF 6 | miR-146b-5p mediates p16-dependent repression of IL-6 and suppresses paracrine procarcinogenic effects of breast stromal fibroblasts. Oncotarget. 2015 Oct 6;6(30):30006-16. | ||||
| REF 7 | Family of microRNA-146 Regulates RAR in Papillary Thyroid Carcinoma. PLoS One. 2016 Mar 24;11(3):e0151968. | ||||
| REF 8 | A cellular micro-RNA, let-7i, regulates Toll-like receptor 4 expression and contributes to cholangiocyte immune responses against Cryptosporidium parvum infection. J Biol Chem. 2007 Sep 28;282(39):28929-38. | ||||
| REF 9 | Expression of microRNA-146 suppresses NF-kappaB activity with reduction of metastatic potential in breast cancer cells. Oncogene. 2008 Sep 18;27(42):5643-7. | ||||
| REF 10 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
| REF 11 | Inhibition of miR-146b expression increases radioiodine-sensitivity in poorly differential thyroid carcinoma via positively regulating NIS expression. Biochem Biophys Res Commun. 2015 Jul 10;462(4):314-21. | ||||
| REF 12 | NF-kappaB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci U S A. 2006 Aug 15;103(33):12481-6. | ||||
| REF 13 | microRNA-146b inhibits glioma cell migration and invasion by targeting MMPs. Brain Res. 2009 May 7;1269:158-65. | ||||
| REF 14 | Multiple microRNAs rescue from Ras-induced senescence by inhibiting p21(Waf1/Cip1). Oncogene. 2010 Apr 15;29(15):2262-71. | ||||
| REF 15 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
| REF 16 | Regulation of UHRF1 by miR-146a/b modulates gastric cancer invasion and metastasis.FASEB J. 2013 Dec;27(12):4929-39. | ||||
| REF 17 | Integrated analyses of microRNA and mRNA expression profiles in aggressive papillary thyroid carcinoma.Mol Med Rep. 2013 Nov;8(5):1353-8. | ||||
| REF 18 | MicroRNA-141 and microRNA-146b-5p inhibit the prometastatic mesenchymal characteristics through the RNA-binding protein AUF1 targeting the transcription factor ZEB1 and the protein kinase AKT.J Biol Chem. 2014 Nov 7;289(45):31433-47. | ||||
| REF 19 | The miR-146b-3p/PAX8/NIS Regulatory Circuit Modulates the Differentiation Phenotype and Function of Thyroid Cells during Carcinogenesis.Cancer Res. 2015 Oct 1;75(19):4119-30. | ||||
| REF 20 | NOVA1 inhibition by miR-146b-5p in the remnant tissue microenvironment defines occult residual disease after gastric cancer removal.Oncotarget. 2016 Jan 19;7(3):2475-95. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.