miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-150-3p | ||||
| miRNA Stemloop AC | MI0000479 | ||||
| miRNA Stemloop ID | hsa-mir-150 | ||||
| Sequence | cugguacaggccugggggacag | ||||
| TTD Target(s) Regulated by This miRNA | Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [1] | |
| Beta-catenin (CTNNB1) | Successful Target | Target Info | [2] | ||
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | 60S ribosomal protein L11 | Regulated Protein | [4] | ||
| C-C chemokine receptor type 6 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | Upregulation of miR-150* and miR-630 induces apoptosis in pancreatic cancer cells by targeting IGF-1R. PLoS One. 2013 May 10;8(5):e61015. | ||||
| REF 2 | TNF--induced NF-B activation upregulates microRNA-150-3p and inhibits osteogenesis of mesenchymal stem cells by targeting -catenin. Open Biol. 2016 Mar;6(3). pii: 150258. | ||||
| REF 3 | Genome-Wide CRISPR-Cas9 Screen Identifies MicroRNAs That Regulate Myeloid Leukemia Cell Growth. PLoS One. 2016 Apr 15;11(4):e0153689. | ||||
| REF 4 | Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.FEBS Lett. 2015 Dec 21;589(24 Pt B):3989-97. | ||||
| REF 5 | Histone deacetylase inhibitors inhibit metastasis by restoring a tumor suppressive microRNA-150 in advanced cutaneous T-cell lymphoma.Oncotarget. 2017 Jan 31;8(5):7572-7585. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.