miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-151a-3p | ||||
| miRNA Stemloop AC | MI0000809 | ||||
| miRNA Stemloop ID | hsa-mir-151a | ||||
| Sequence | cuagacugaagcuccuugagg | ||||
| TTD Target(s) Regulated by This miRNA | NT-3 growth factor receptor (TrkC) | Successful Target | Target Info | [1] | |
| G1/S-specific cyclin-E1 (CCNE1) | Literature-reported Target | Target Info | [2] | ||
| Interleukin 12 receptor beta-2 (IL12RB2) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Twist-related protein 1 | Regulated Protein | [4] | ||
| Zinc finger protein 763 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | Overexpression of miR-128 specifically inhibits the truncated isoform of NTRK3 and upregulates BCL2 in SH-SY5Y neuroblastoma cells. BMC Mol Biol. 2010 Dec 10;11:95. | ||||
| REF 2 | A miR-151 binding site polymorphism in the 3'-untranslated region of the cyclin E1 gene associated with nasopharyngeal carcinoma. Biochem Biophys Res Commun. 2013 Mar 22;432(4):660-5. | ||||
| REF 3 | MiR-151a is involved in the pathogenesis of atopic dermatitis by regulating interleukin-12 receptor 2. Exp Dermatol. 2018 Apr;27(4):427-432. | ||||
| REF 4 | miR-151-3p Targets TWIST1 to Repress Migration of Human Breast Cancer Cells.PLoS One. 2016 Dec 8;11(12):e0168171. | ||||
| REF 5 | MicroRNA-181a modulates gene expression of zinc finger family members by directly targeting their coding regions.Nucleic Acids Res. 2010 Nov;38(20):7211-8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.