miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-151a-5p | ||||
| miRNA Stemloop AC | MI0000809 | ||||
| miRNA Stemloop ID | hsa-mir-151a | ||||
| Sequence | ucgaggagcucacagucuagu | ||||
| TTD Target(s) Regulated by This miRNA | Thrombopoietin receptor (MPL) | Successful Target | Target Info | [1] | |
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Cytochrome b | Regulated Protein | [3] | ||
| Interleukin-1 receptor accessory protein-like 1 | Regulated Protein | [4] | |||
| NEDD4-binding protein 1 | Regulated Protein | [1] | |||
| Rho GDP-dissociation inhibitor 1 | Regulated Protein | [6] | |||
| SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 | Regulated Protein | [7] | |||
| Transcription factor E2F6 | Regulated Protein | [1] | |||
| Transcription factor SOX-17 | Regulated Protein | [8] | |||
| Zinc finger protein castor homolog 1 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | miR-28 is a thrombopoietin receptor targeting microRNA detected in a fraction of myeloproliferative neoplasm patient platelets. Blood. 2010 Jul 22;116(3):437-45. | ||||
| REF 2 | Notch1 pathway-mediated microRNA-151-5p promotes gastric cancer progression. Oncotarget. 2016 Jun 21;7(25):38036-38051. | ||||
| REF 3 | Mitochondria-related miR-151a-5p reduces cellular ATP production by targeting CYTB in asthenozoospermia.Sci Rep. 2015 Dec 2;5:17743. | ||||
| REF 4 | Genistein suppresses prostate cancer growth through inhibition of oncogenic microRNA-151.PLoS One. 2012;7(8):e43812. | ||||
| REF 5 | miR-28 is a thrombopoietin receptor targeting microRNA detected in a fraction of myeloproliferative neoplasm patient platelets. Blood. 2010 Jul 22;116(3):437-45. | ||||
| REF 6 | Gain of miR-151 on chromosome 8q24.3 facilitates tumour cell migration and spreading through downregulating RhoGDIA.Nat Cell Biol. 2010 Apr;12(4):390-9. | ||||
| REF 7 | miR-151-5p, targeting chromatin remodeler SMARCA5, as a marker for the BRCAness phenotype.Oncotarget. 2016 Dec 6;7(49):80363-80372. | ||||
| REF 8 | Changes in microRNA expression during differentiation of embryonic and induced pluripotent stem cells to definitive endoderm.Gene Expr Patterns. 2015 Sep-Nov;19(1-2):70-82. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.