miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-152-3p | ||||
| miRNA Stemloop AC | MI0000462 | ||||
| miRNA Stemloop ID | hsa-mir-152 | ||||
| Sequence | ucagugcaugacagaacuugg | ||||
| TTD Target(s) Regulated by This miRNA | Gastrin/cholecystokinin type B receptor (CCKBR) | Successful Target | Target Info | [1] | |
| Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [2] | ||
| Fibroblast growth factor-2 (FGF2) | Successful Target | Target Info | [3] | ||
| Neuropilin-1 (NRP1) | Successful Target | Target Info | [4] | ||
| Programmed cell death 1 ligand 1 (PD-L1) | Successful Target | Target Info | [5] | ||
| Fibroblast growth factor receptor 3 (FGFR3) | Successful Target | Target Info | [6] | ||
| TNF alpha converting enzyme (ADAM17) | Clinical trial Target | Target Info | [7] | ||
| DNA [cytosine-5]-methyltransferase 1 (DNMT1) | Clinical trial Target | Target Info | [8] | ||
| Integrin alpha-5 (ITGA5) | Clinical trial Target | Target Info | [9] | ||
| Dickkopf-related protein 1 (DKK1) | Clinical trial Target | Target Info | [10] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [6] | ||
| Macrophage colony-stimulating factor 1 (CSF1) | Clinical trial Target | Target Info | [11] | ||
| Transforming growth factor alpha (TGFA) | Clinical trial Target | Target Info | [12] | ||
| Kruppel like factor 4 (KLF4) | Clinical trial Target | Target Info | [13] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [14] | ||
| Activated leukocyte cell adhesionmolecule (ALCAM) | Clinical trial Target | Target Info | [15] | ||
| Insulin receptor substrate-1 (IRS1) | Clinical trial Target | Target Info | [2] | ||
| Transforming acidic coiled-coil protein 3 (TACC3) | Literature-reported Target | Target Info | [6] | ||
| Protein(s) Regulated by This miRNA | Beclin 1-associated autophagy-related key regulator | Regulated Protein | [16] | ||
| Beta-1,4-galactosyltransferase 5 | Regulated Protein | [17] | |||
| CD151 antigen | Regulated Protein | [18] | |||
| Circadian locomoter output cycles protein kaput | Regulated Protein | [17] | |||
| E3 ubiquitin-protein transferase RMND5A | Regulated Protein | [17] | |||
| Epithelial membrane protein 1 | Regulated Protein | [17] | |||
| HLA class I histocompatibility antigen, alpha chain G | Regulated Protein | [19] | |||
| Max dimerization protein 1 | Regulated Protein | [17] | |||
| Motile sperm domain-containing protein 1 | Regulated Protein | [17] | |||
| Phosphatase and actin regulator 2 | Regulated Protein | [17] | |||
| Phosphatidylinositol 3-kinase regulatory subunit gamma | Regulated Protein | [20] | |||
| Proto-oncogene Wnt-1 | Regulated Protein | [21] | |||
| STE20-related kinase adapter protein beta | Regulated Protein | [17] | |||
| Transcription factor MafB | Regulated Protein | [6] | |||
| Uncharacterized protein C18orf25 | Regulated Protein | [17] | |||
| Uncharacterized protein KIAA0232 | Regulated Protein | [17] | |||
| References | |||||
| REF 1 | Altered expression of MiR-148a and MiR-152 in gastrointestinal cancers and its clinical significance. J Gastrointest Surg. 2010 Jul;14(7):1170-9. | ||||
| REF 2 | A regulatory circuit of miR-148a/152 and DNMT1 in modulating cell transformation and tumor angiogenesis through IGF-IR and IRS1. J Mol Cell Biol. 2013 Feb;5(1):3-13. | ||||
| REF 3 | MiR-152 suppresses the proliferation and invasion of NSCLC cells by inhibiting FGF2. Exp Mol Med. 2014 Sep 5;46:e112. | ||||
| REF 4 | MiR-152 regulates metastases of non-small cell lung cancer cells by targeting neuropilin-1. Int J Clin Exp Pathol. 2015 Nov 1;8(11):14235-40. | ||||
| REF 5 | MicroRNA-152 regulates immune response via targeting B7-H1 in gastric carcinoma. Oncotarget. 2017 Apr 25;8(17):28125-28134. | ||||
| REF 6 | Downregulation of specific miRNAs in hyperdiploid multiple myeloma mimics the oncogenic effect of IgH translocations occurring in the non-hyperdiploid subtype. Leukemia. 2013 Apr;27(4):925-31. | ||||
| REF 7 | MicroRNA-152 targets ADAM17 to suppress NSCLC progression. FEBS Lett. 2014 May 21;588(10):1983-8. | ||||
| REF 8 | MicroRNA-dependent regulation of DNA methyltransferase-1 and tumor suppressor gene expression by interleukin-6 in human malignant cholangiocytes. Hepatology. 2010 Mar;51(3):881-90. | ||||
| REF 9 | MicroRNA-152 and -181a participate in human dermal fibroblasts senescence acting on cell adhesion and remodeling of the extra-cellular matrix. Aging (Albany NY). 2012 Nov;4(11):843-53. | ||||
| REF 10 | Downregulation of MicroRNA-152 contributes to high expression of DKK1 in multiple myeloma. RNA Biol. 2015;12(12):1314-22. | ||||
| REF 11 | Regulation of colony stimulating factor-1 expression and ovarian cancer cell behavior in vitro by miR-128 and miR-152. Mol Cancer. 2012 Aug 21;11:58. | ||||
| REF 12 | miR-152 controls migration and invasive potential by targeting TGF in prostate cancer cell lines. Prostate. 2013 Jul;73(10):1082-9. | ||||
| REF 13 | TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41. | ||||
| REF 14 | Tanshinone IIA inhibits apoptosis in the myocardium by inducing microRNA-152-3p expression and thereby downregulating PTEN. Am J Transl Res. 2016 Jul 15;8(7):3124-32. | ||||
| REF 15 | MiR-148a and miR-152 reduce tamoxifen resistance in ER+ breast cancer via downregulating ALCAM. Biochem Biophys Res Commun. 2017 Feb 5;483(2):840-846. | ||||
| REF 16 | Downregulation of ATG14 by EGR1-MIR152 sensitizes ovarian cancer cells to cisplatin-induced apoptosis by inhibiting cyto-protective autophagy.Autophagy. 2015;11(2):373-84. | ||||
| REF 17 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
| REF 18 | miR-152 suppresses gastric cancer cell proliferation and motility by targeting CD151.Tumour Biol. 2014 Nov;35(11):11367-73. | ||||
| REF 19 | Allele-specific targeting of microRNAs to HLA-G and risk of asthma.Am J Hum Genet. 2007 Oct;81(4):829-34. | ||||
| REF 20 | miR-152 functions as a tumor suppressor in colorectal cancer by targeting PIK3R3.Tumour Biol. 2016 Aug;37(8):10075-84. | ||||
| REF 21 | HCV core protein-induced down-regulation of microRNA-152 promoted aberrant proliferation by regulating Wnt1 in HepG2 cells.PLoS One. 2014 Jan 9;9(1):e81730. | ||||
| REF 22 | Downregulation of specific miRNAs in hyperdiploid multiple myeloma mimics the oncogenic effect of IgH translocations occurring in the non-hyperdiploid subtype. Leukemia. 2013 Apr;27(4):925-31. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.