miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-154-5p | ||||
| miRNA Stemloop AC | MI0000480 | ||||
| miRNA Stemloop ID | hsa-mir-154 | ||||
| Sequence | uagguuauccguguugccuucg | ||||
| TTD Target(s) Regulated by This miRNA | Toll-like receptor 2 (TLR2) | Clinical trial Target | Target Info | [1] | |
| Zinc finger E-box-binding homeobox 2 (ZEB2) | Literature-reported Target | Target Info | [2] | ||
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [3] | ||
| Wnt-5a protein (WNT5A) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | G1/S-specific cyclin-D2 | Regulated Protein | [5] | ||
| Transcription factor E2F5 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31. | ||||
| REF 2 | miR-154 targeting ZEB2 in hepatocellular carcinoma functions as a potential tumor suppressor. Oncol Rep. 2015 Dec;34(6):3272-9. | ||||
| REF 3 | miR-154 inhibits EMT by targeting HMGA2 in prostate cancer cells. Mol Cell Biochem. 2013 Jul;379(1-2):69-75. | ||||
| REF 4 | MiR-154 Functions as a Tumor Suppressor in Glioblastoma by Targeting Wnt5a. Mol Neurobiol. 2017 May;54(4):2823-2830. | ||||
| REF 5 | miR-154 inhibits prostate cancer cell proliferation by targeting CCND2.Urol Oncol. 2014 Jan;32(1):31.e9-16. | ||||
| REF 6 | miRNA-154-5p Inhibits Proliferation, Migration and Invasion by Targeting E2F5 in Prostate Cancer Cell Lines.Urol Int. 2017;98(1):102-110. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.