miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-155-3p | ||||
| miRNA Stemloop AC | MI0000681 | ||||
| miRNA Stemloop ID | hsa-mir-155 | ||||
| Sequence | cuccuacauauuagcauuaaca | ||||
| TTD Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Successful Target | Target Info | [1] | |
| Interleukin-17 (IL17) | Successful Target | Target Info | [2] | ||
| NAD-dependent deacetylase sirtuin-1 (SIRT1) | Clinical trial Target | Target Info | [3] | ||
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [4] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [5] | ||
| IL-1 receptor-associated kinase 3 (IRAK3) | Literature-reported Target | Target Info | [6] | ||
| F-box and WD-40 domain protein 7 (Fbxw7) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | CREB3 regulatory factor | Regulated Protein | [8] | ||
| Interleukin-3 | Regulated Protein | [9] | |||
| References | |||||
| REF 1 | miR-155 downregulates ErbB2 and suppresses ErbB2-induced malignant transformation of breast epithelial cells. Oncogene. 2016 Nov 17;35(46):6015-6025. | ||||
| REF 2 | MicroRNA-155 regulates host immune response to postviral bacterial pneumonia via IL-23/IL-17 pathway. Am J Physiol Lung Cell Mol Physiol. 2016 Mar 1;310(5):L465-75. | ||||
| REF 3 | miR-124a and miR-155 enhance differentiation of regulatory T cells in patients with neuropathic pain. J Neuroinflammation. 2016 Sep 20;13(1):248. | ||||
| REF 4 | Combining Anti-Mir-155 with Chemotherapy for the Treatment of Lung Cancers. Clin Cancer Res. 2017 Jun 1;23(11):2891-2904. | ||||
| REF 5 | miR-155* mediates suppressive effect of PTEN 3'-untranslated region on AP-1/NF-B pathway in HTR-8/SVneo cells. Placenta. 2013 Aug;34(8):650-6. | ||||
| REF 6 | miR-155 and its star-form partner miR-155* cooperatively regulate type I interferon production by human plasmacytoid dendritic cells. Blood. 2010 Dec 23;116(26):5885-94. | ||||
| REF 7 | MicroRNA-155-3p promotes hepatocellular carcinoma formation by suppressing FBXW7 expression. J Exp Clin Cancer Res. 2016 Jun 16;35(1):93. | ||||
| REF 8 | A novel tumor-promoting mechanism of IL6 and the therapeutic efficacy of tocilizumab: Hypoxia-induced IL6 is a potent autophagy initiator in glioblastoma via the p-STAT3-MIR155-3p-CREBRF pathway.Autophagy. 2016 Jul 2;12(7):1129-52. | ||||
| REF 9 | miR-155 as a potential target of IL-3 signaling in primary AML cells.Leuk Res. 2017 Jun;57:57-59. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.