miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-16-5p
miRNA Stemloop AC MI0000070 | MI0000115
miRNA Stemloop ID hsa-mir-16-1 | hsa-mir-16-2
Sequence uagcagcacguaaauauuggcg
TTD Target(s) Regulated by This miRNA Fibroblast growth factor receptor 1 (FGFR1) Successful Target Target Info [1]
Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [2]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [3]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [4]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [5]
Wilms tumor protein (WT1) Clinical trial Target Target Info [6]
G1/S-specific cyclin-E1 (CCNE1) Literature-reported Target Target Info [7]
Polycomb complex protein BMI-1 (BMI1) Clinical trial Target Target Info [8]
Cyclin D (CCND3) Literature-reported Target Target Info [9]
High mobility group protein HMG-I/Y (HMGA1) Literature-reported Target Target Info [10]
Corticotropin-releasing factor binding protein (CRHBP) Literature-reported Target Target Info [6]
Suppressor of tumorigenicity 15 protein (ST15) Literature-reported Target Target Info [11]
Protein(s) Regulated by This miRNA #VALUE! Regulated Protein
Q2VCE5_HUMAN
[12]
Arginine--tRNA ligase, cytoplasmic Regulated Protein
SYRC_HUMAN
[13]
Axin-2 Regulated Protein
AXIN2_HUMAN
[14]
Breast cancer type 1 susceptibility protein Regulated Protein
BRCA1_HUMAN
[15]
Caprin-1 Regulated Protein
CAPR1_HUMAN
[10]
Cell adhesion molecule 1 Regulated Protein
CADM1_HUMAN
[6]
Claudin-2 Regulated Protein
CLD2_HUMAN
[18]
Cyclin-J Regulated Protein
CCNJ_HUMAN
[19]
Cyclin-T2 Regulated Protein
CCNT2_HUMAN
[20]
eEF1A lysine and N-terminal methyltransferase Regulated Protein
MET13_HUMAN
[21]
Ensconsin Regulated Protein
MAP7_HUMAN
[22]
Far upstream element-binding protein 1 Regulated Protein
FUBP1_HUMAN
[19]
G1/S-specific cyclin-D2 Regulated Protein
CCND2_HUMAN
[23]
Glutaminase liver isoform, mitochondrial Regulated Protein
GLSL_HUMAN
[12]
Nicastrin Regulated Protein
NICA_HUMAN
[24]
Nuclear receptor corepressor 2 Regulated Protein
NCOR2_HUMAN
[25]
Phosphatidate cytidylyltransferase 2 Regulated Protein
CDS2_HUMAN
[22]
PR domain zinc finger protein 4 Regulated Protein
PRDM4_HUMAN
[22]
Programmed cell death protein 4 Regulated Protein
PDCD4_HUMAN
[6]
Protein Wnt-3a Regulated Protein
WNT3A_HUMAN
[26]
Protein Wnt-4 Regulated Protein
WNT4_HUMAN
[27]
Ras-related protein Rab-21 Regulated Protein
RAB21_HUMAN
[6]
Rho GDP-dissociation inhibitor 1 Regulated Protein
GDIR1_HUMAN
[28]
Src kinase-associated phosphoprotein 2 Regulated Protein
SKAP2_HUMAN
[6]
Transcription factor SOX-6 Regulated Protein
SOX6_HUMAN
[29]
Transcriptional activator protein Pur-alpha Regulated Protein
PURA_HUMAN
[30]
Tubulin polymerization-promoting protein family member 3 Regulated Protein
TPPP3_HUMAN
[20]
Uracil-DNA glycosylase Regulated Protein
UNG_HUMAN
[31]
Zyxin Regulated Protein
ZYX_HUMAN
[32]
References
REF 1 MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9.
REF 2 Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
REF 3 miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9.
REF 4 The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 5 MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57.
REF 6 MiR-15a and miR-16-1 cluster functions in human leukemia. Proc Natl Acad Sci U S A. 2008 Apr 1;105(13):5166-71.
REF 7 miR-16 family induces cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids Res. 2008 Sep;36(16):5391-404.
REF 8 Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. Cancer Res. 2008 Nov 15;68(22):9125-30.
REF 9 Downregulation of CCND1 and CDK6 by miR-34a induces cell cycle arrest. FEBS Lett. 2008 Apr 30;582(10):1564-8.
REF 10 Two new miR-16 targets: caprin-1 and HMGA1, proteins implicated in cell proliferation. Biol Cell. 2009 Sep;101(9):511-24.
REF 11 MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.
REF 12 Long non-coding RNA UCA1 promotes glutamine metabolism by targeting miR-16 in human bladder cancer.Jpn J Clin Oncol. 2015 Nov;45(11):1055-63.
REF 13 Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A. 2002 Nov 26;99(24):15524-9.
REF 14 MicroRNAs modulate the Wnt signaling pathway through targeting its inhibitors.Biochem Biophys Res Commun. 2011 May 6;408(2):259-64.
REF 15 Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas.J Virol. 2009 Apr;83(7):3333-41.
REF 16 Two new miR-16 targets: caprin-1 and HMGA1, proteins implicated in cell proliferation. Biol Cell. 2009 Sep;101(9):511-24.
REF 17 MiR-15a and miR-16-1 cluster functions in human leukemia. Proc Natl Acad Sci U S A. 2008 Apr 1;105(13):5166-71.
REF 18 miR-16 and miR-125b are involved in barrier function dysregulation through the modulation of claudin-2 and cingulin expression in the jejunum in IBS with diarrhoea.Gut. 2017 Sep;66(9):1537-1538.
REF 19 MiR-16 mediates trastuzumab and lapatinib response in ErbB-2-positive breast and gastric cancer via its novel targets CCNJ and FUBP1.Oncogene. 2016 Dec 1;35(48):6189-6202.
REF 20 A combined computational-experimental approach predicts human microRNA targets. Genes Dev. 2004 May 15;18(10):1165-78.
REF 21 miR-16 promotes the apoptosis of human cancer cells by targeting FEAT.BMC Cancer. 2015 Jun 2;15:448.
REF 22 The identification of novel targets of miR-16 and characterization of their biological functions in cancer cells.Mol Cancer. 2013 Aug 14;12:92.
REF 23 c-Myc Represses Tumor-Suppressive microRNAs, let-7a, miR-16 and miR-29b, and Induces Cyclin D2-Mediated Cell Proliferation in Ewing's Sarcoma Cell Line.PLoS One. 2015 Sep 22;10(9):e0138560.
REF 24 Preclinical Evaluation of miR-15/107 Family Members as Multifactorial Drug Targets for Alzheimer's Disease.Mol Ther Nucleic Acids. 2015 Oct 6;4:e256.
REF 25 miR-16 targets transcriptional corepressor SMRT and modulates NF-kappaB-regulated transactivation of interleukin-8 gene.PLoS One. 2012;7(1):e30772.
REF 26 The miR-15a-miR-16-1 cluster controls prostate cancer by targeting multiple oncogenic activities. Nat Med. 2008 Nov;14(11):1271-7.
REF 27 Chronic academic stress increases a group of microRNAs in peripheral blood.PLoS One. 2013 Oct 9;8(10):e75960.
REF 28 Interplay between PCBP2 and miRNA modulates ARHGDIA expression and function in glioma migration and invasion.Oncotarget. 2016 Apr 12;7(15):19483-98.
REF 29 MiR-16 induced the suppression of cell apoptosis while promote proliferation in esophageal squamous cell carcinoma.Cell Physiol Biochem. 2014;33(5):1340-8.
REF 30 Translation of Pur- is targeted by cellular miRNAs to modulate the differentiation-dependent susceptibility of monocytes to HIV-1 infection.FASEB J. 2012 Nov;26(11):4755-64.
REF 31 Multiple microRNAs may regulate the DNA repair enzyme uracil-DNA glycosylase.DNA Repair (Amst). 2013 Jan 1;12(1):80-6.
REF 32 MicroRNA-16 targets zyxin and promotes cell motility in human laryngeal carcinoma cell line HEp-2.IUBMB Life. 2011 Feb;63(2):101-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.