miRNA General Information
miRNA Mature ID	hsa-miR-181a-5p
miRNA Stemloop AC	MI0000269 | MI0000289
miRNA Stemloop ID	hsa-mir-181a-2 | hsa-mir-181a-1
Sequence	aacauucaacgcugucggugagu
TTD Target(s) Regulated by This miRNA	Estrogen receptor (ESR)	Successful Target	Target Info	[1]
	Apoptosis regulator Bcl-2 (BCL-2)	Successful Target	Target Info	[2]
	CDK inhibitor 1B p27Kip1 (CDKN1B)	Literature-reported Target	Target Info	[3]
	Homeobox protein Hox-A11 (HOXA11)	Literature-reported Target	Target Info	[4]
Protein(s) Regulated by This miRNA	Apoptosis regulator BAX	Regulated Protein	BAX_HUMAN	[5]
	ATP-dependent RNA helicase DDX3X	Regulated Protein	DDX3X_HUMAN	[6]
	Autophagy protein 5	Regulated Protein	ATG5_HUMAN	[7]
	Bcl-2-like protein 11	Regulated Protein	B2L11_HUMAN	[8]
	Bcl-2-like protein 11	Regulated Protein	B2L11_HUMAN	[9]
	CCAAT/enhancer-binding protein alpha	Regulated Protein	CEBPA_HUMAN	[10]
	Collagen alpha-1(XVI) chain	Regulated Protein	COGA1_HUMAN	[11]
	CTD small phosphatase-like protein	Regulated Protein	CTDSL_HUMAN	[12]
	Deoxynucleoside triphosphate triphosphohydrolase SAMHD1	Regulated Protein	SAMH1_HUMAN	[13]
	Dual specificity protein phosphatase 6	Regulated Protein	DUS6_HUMAN	[14]
	E3 ubiquitin-protein ligase parkin	Regulated Protein	PRKN_HUMAN	[15]
	E3 ubiquitin-protein ligase RING2	Regulated Protein	RING2_HUMAN	[16]
	G-protein coupled receptor 78	Regulated Protein	GPR78_HUMAN	[17]
	Glycerol-3-phosphate dehydrogenase 1-like protein	Regulated Protein	GPD1L_HUMAN	[18]
	Homeobox protein CDX-2	Regulated Protein	CDX2_HUMAN	[19]
	Krueppel-like factor 6	Regulated Protein	KLF6_HUMAN	[20]
	Metalloproteinase inhibitor 1	Regulated Protein	TIMP1_HUMAN	[6]
	Motile sperm domain-containing protein 1	Regulated Protein	MSPD1_HUMAN	[21]
	Myotubularin-related protein 3	Regulated Protein	MTMR3_HUMAN	[22]
	PH domain leucine-rich repeat-containing protein phosphatase 2	Regulated Protein	PHLP2_HUMAN	[23]
	Phosphatase and actin regulator 2	Regulated Protein	PHAR2_HUMAN	[21]
	Phosphatase and actin regulator 4	Regulated Protein	PHAR4_HUMAN	[21]
	Pleckstrin homology-like domain family A member 1	Regulated Protein	PHLA1_HUMAN	[21]
	Pre-B-cell leukemia transcription factor 3	Regulated Protein	PBX3_HUMAN	[24]
	Proline-rich acidic protein 1	Regulated Protein	PRAP1_HUMAN	[25]
	Prospero homeobox protein 1	Regulated Protein	PROX1_HUMAN	[26]
	Ras association domain-containing protein 1	Regulated Protein	RASF1_HUMAN	[27]
	Ras association domain-containing protein 6	Regulated Protein	RASF6_HUMAN	[28]
	Ras-related protein Ral-A	Regulated Protein	RALA_HUMAN	[29]
	Ras-related protein Rap-1b	Regulated Protein	RAP1B_HUMAN	[30]
	Regulator of G-protein signaling 5	Regulated Protein	RGS5_HUMAN	[31]
	Retinal dehydrogenase 1	Regulated Protein	AL1A1_HUMAN	[32]
	Runt-related transcription factor 1	Regulated Protein	RUNX1_HUMAN	[33]
	SAM and SH3 domain-containing protein 1	Regulated Protein	SASH1_HUMAN	[21]
	Serine/threonine-protein kinase NLK	Regulated Protein	NLK_HUMAN	[19]
	SLIT-ROBO Rho GTPase-activating protein 1	Regulated Protein	SRGP1_HUMAN	[21]
	Transcription factor 4	Regulated Protein	ITF2_HUMAN	[34]
	Transcription factor E2F5	Regulated Protein	E2F5_HUMAN	[35]
	Transcription factor GATA-6	Regulated Protein	GATA6_HUMAN	[19]
	Transforming growth factor-beta receptor-associated protein 1	Regulated Protein	TGFA1_HUMAN	[36]
	Tumor suppressor candidate 3	Regulated Protein	TUSC3_HUMAN	[37]
	Twist-related protein 1	Regulated Protein	TWST1_HUMAN	[38]
	Type II inositol 3,4-bisphosphate 4-phosphatase	Regulated Protein	INP4B_HUMAN	[39]
	Tyrosine-protein phosphatase non-receptor type 22	Regulated Protein	PTN22_HUMAN	[14]
	Ubiquitin-like protein 3	Regulated Protein	UBL3_HUMAN	[21]
	Uncharacterized protein C12orf29	Regulated Protein	CL029_HUMAN	[21]
	Wnt inhibitory factor 1	Regulated Protein	WIF1_HUMAN	[40]
	Zinc finger protein 763	Regulated Protein	ZN763_HUMAN	[41]
	Zinc finger protein PLAG1	Regulated Protein	PLAG1_HUMAN	[42]
References
REF 1	The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47.
REF 2	miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9.
REF 3	miR-221 and miR-222 expression affects the proliferation potential of human prostate carcinoma cell lines by targeting p27Kip1. J Biol Chem. 2007 Aug 10;282(32):23716-24.
REF 4	The microRNA miR-181 targets the homeobox protein Hox-A11 during mammalian myoblast differentiation. Nat Cell Biol. 2006 Mar;8(3):278-84.
REF 5	Induction of miRNA-181a by genotoxic treatments promotes chemotherapeutic resistance and metastasis in breast cancer.Oncogene. 2016 Mar 10;35(10):1302-1313.
REF 6	Endometrial miR-181a and miR-98 expression is altered during transition from normal into cancerous state and target PGR, PGRMC1, CYP19A1, DDX3X, and TIMP3. J Clin Endocrinol Metab. 2012 Jul;97(7):E1316-26.
REF 7	MIR181A regulates starvation- and rapamycin-induced autophagy through targeting of ATG5.Autophagy. 2013 Mar;9(3):374-85.
REF 8	Follicular dendritic cell-dependent drug resistance of non-Hodgkin lymphoma involves cell adhesion-mediated Bim down-regulation through induction of microRNA-181a.Blood. 2010 Dec 9;116(24):5228-36.
REF 9	TGF- upregulates miR-181a expression to promote breast cancer metastasis.J Clin Invest. 2013 Jan;123(1):150-63.
REF 10	miR-181a Induces Macrophage Polarized to M2 Phenotype and Promotes M2 Macrophage-mediated Tumor Cell Metastasis by Targeting KLF6 and C/EBP.Mol Ther Nucleic Acids. 2016 Sep 27;5(9):e368.
REF 11	MicroRNA-152 and -181a participate in human dermal fibroblasts senescence acting on cell adhesion and remodeling of the extra-cellular matrix. Aging (Albany NY). 2012 Nov;4(11):843-53.
REF 12	MiR-181 family: regulators of myeloid differentiation and acute myeloid leukemia as well as potential therapeutic targets.Oncogene. 2015 Jun;34(25):3226-39.
REF 13	Sterile alpha motif and histidine/aspartic acid domain-containing protein 1 (SAMHD1)-facilitated HIV restriction in astrocytes is regulated by miRNA-181a.J Neuroinflammation. 2015 Apr 8;12:66.
REF 14	miR-181a is an intrinsic modulator of T cell sensitivity and selection.Cell. 2007 Apr 6;129(1):147-61.
REF 15	MicroRNA-181a suppresses parkin-mediated mitophagy and sensitizes neuroblastoma cells to mitochondrial uncoupler-induced apoptosis.Oncotarget. 2016 Jul 5;7(27):42274-42287.
REF 16	Coordinated regulation of polycomb group complexes through microRNAs in cancer. Cancer Cell. 2011 Aug 16;20(2):187-99.
REF 17	miR-30d, miR-181a and miR-199a-5p cooperatively suppress the endoplasmic reticulum chaperone and signaling regulator GRP78 in cancer.Oncogene. 2013 Sep 26;32(39):4694-701.
REF 18	miR-181a Modulates Chondrocyte Apoptosis by Targeting Glycerol-3-Phosphate Dehydrogenase 1-Like Protein (GPD1L) in Osteoarthritis.Med Sci Monit. 2017 Mar 10;23:1224-1231.
REF 19	Identification of microRNA-181 by genome-wide screening as a critical player in EpCAM-positive hepatic cancer stem cells.Hepatology. 2009 Aug;50(2):472-80.
REF 20	MicroRNA-181a promotes gastric cancer by negatively regulating tumor suppressor KLF6.Tumour Biol. 2012 Oct;33(5):1589-97.
REF 21	MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 22	Genetic polymorphism at miR-181a binding site contributes to gastric cancer susceptibility.Carcinogenesis. 2012 Dec;33(12):2377-83.
REF 23	MiR-181a Targets PHLPP2 to Augment AKT Signaling and Regulate Proliferation and Apoptosis in Human Keloid Fibroblasts. Cell Physiol Biochem. 2016;40(3-4):796-806.
REF 24	Up-regulation of a HOXA-PBX3 homeobox-gene signature following down-regulation of miR-181 is associated with adverse prognosis in patients with cytogenetically abnormal AML.Blood. 2012 Mar 8;119(10):2314-24.
REF 25	Impaired MicroRNA Processing Facilitates Breast Cancer Cell Invasion by Upregulating Urokinase-Type Plasminogen Activator Expression.Genes Cancer. 2011 Feb;2(2):140-50.
REF 26	Prox1 expression is negatively regulated by miR-181 in endothelial cells.Blood. 2010 Sep 30;116(13):2395-401.
REF 27	PML/RAR-Regulated miR-181a/b Cluster Targets the Tumor Suppressor RASSF1A in Acute Promyelocytic Leukemia.Cancer Res. 2015 Aug 15;75(16):3411-24.
REF 28	miR-181a-5p promotes the progression of gastric cancer via RASSF6-mediated MAPK signalling activation.Cancer Lett. 2017 Mar 28;389:11-22.
REF 29	miR-181a post-transcriptionally downregulates oncogenic RalA and contributes to growth inhibition and apoptosis in chronic myelogenous leukemia (CML).PLoS One. 2012;7(3):e32834.
REF 30	miR-181 subunits enhance the chemosensitivity of temozolomide by Rap1B-mediated cytoskeleton remodeling in glioblastoma cells.Med Oncol. 2014 Apr;31(4):892.
REF 31	Focal DNA copy number changes in neuroblastoma target MYCN regulated genes.PLoS One. 2013;8(1):e52321.
REF 32	Human papillomavirus 16 (HPV16) enhances tumor growth and cancer stemness of HPV-negative oral/oropharyngeal squamous cell carcinoma cells via miR-181 regulation.Papillomavirus Res. 2015 Dec 1;1:116-125.
REF 33	A Double Negative Loop Comprising ETV6/RUNX1 and MIR181A1 Contributes to Differentiation Block in t(12;21)-Positive Acute Lymphoblastic Leukemia.PLoS One. 2015 Nov 18;10(11):e0142863.
REF 34	The lncRNA CRNDE promotes colorectal cancer cell proliferation and chemoresistance via miR-181a-5p-mediated regulation of Wnt/-catenin signaling.Mol Cancer. 2017 Jan 13;16(1):9.
REF 35	Up-regulated MicroRNA-181a induces carcinogenesis in hepatitis B virus-related hepatocellular carcinoma by targeting E2F5.BMC Cancer. 2014 Feb 17;14:97.
REF 36	MicroRNA-181a regulates local immune balance by inhibiting proliferation and immunosuppressive properties of mesenchymal stem cells.Stem Cells. 2012 Aug;30(8):1756-70.
REF 37	SOX2 regulates multiple malignant processes of breast cancer development through the SOX2/miR-181a-5p, miR-30e-5p/TUSC3 axis.Mol Cancer. 2017 Mar 14;16(1):62.
REF 38	miR-181a-Twist1 pathway in the chemoresistance of tongue squamous cell carcinoma.Biochem Biophys Res Commun. 2013 Nov 15;441(2):364-70.
REF 39	miR-181 elevates Akt signaling by co-targeting PHLPP2 and INPP4B phosphatases in luminal breast cancer.Int J Cancer. 2017 May 15;140(10):2310-2320.
REF 40	MicroRNA-181a promotes tumor growth and liver metastasis in colorectal cancer by targeting the tumor suppressor WIF-1.Mol Cancer. 2014 Apr 23;13:86.
REF 41	MicroRNA-181a modulates gene expression of zinc finger family members by directly targeting their coding regions.Nucleic Acids Res. 2010 Nov;38(20):7211-8.
REF 42	miRNA deregulation by epigenetic silencing disrupts suppression of the oncogene PLAG1 in chronic lymphocytic leukemia.Blood. 2009 Oct 8;114(15):3255-64.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.