miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-182-3p | ||||
| miRNA Stemloop AC | MI0000272 | ||||
| miRNA Stemloop ID | hsa-mir-182 | ||||
| Sequence | ugguucuagacuugccaacua | ||||
| TTD Target(s) Regulated by This miRNA | NADPH oxidase 4 (NOX4) | Clinical trial Target | Target Info | [1] | |
| F-box and WD-40 domain protein 7 (Fbxw7) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Myeloid-associated differentiation marker | Regulated Protein | [3] | ||
| Protein SCO2 homolog, mitochondrial | Regulated Protein | [4] | |||
| Signal transducer and activator of transcription 5B | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | microRNA-182 Mediates Sirt1-Induced Diabetic Corneal Nerve Regeneration. Diabetes. 2016 Jul;65(7):2020-31. | ||||
| REF 2 | MiR-182 promotes proliferation and invasion and elevates the HIF-1-VEGF-A axis in breast cancer cells by targeting FBXW7. Am J Cancer Res. 2016 Aug 1;6(8):1785-98. | ||||
| REF 3 | Oncological miR-182-3p, a Novel Smooth Muscle Cell Phenotype Modulator, Evidences From Model Rats and Patients.Arterioscler Thromb Vasc Biol. 2016 Jul;36(7):1386-97. | ||||
| REF 4 | The oncoprotein HBXIP promotes glucose metabolism reprogramming via downregulating SCO2 and PDHA1 in breast cancer.Oncotarget. 2015 Sep 29;6(29):27199-213. | ||||
| REF 5 | STAT5 reactivation by catechin modulates H2O 2-induced apoptosis through miR-182/FOXO1 pathway in SK-N-MC cells.Cell Biochem Biophys. 2015 Mar;71(2):649-56. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.