miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-184 | ||||
| miRNA Stemloop AC | MI0000481 | ||||
| miRNA Stemloop ID | hsa-mir-184 | ||||
| Sequence | uggacggagaacugauaagggu | ||||
| TTD Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [1] | |
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [2] | ||
| Protein kinase C beta (PRKCB) | Clinical trial Target | Target Info | [2] | ||
| Platelet-derived growth factor B (PDGFB) | Clinical trial Target | Target Info | [3] | ||
| Pyruvate kinase M2 (PKM) | Clinical trial Target | Target Info | [4] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [1] | ||
| RAC-beta serine/threonine-protein kinase (AKT2) | Literature-reported Target | Target Info | [5] | ||
| Protein(s) Regulated by This miRNA | Bridging integrator 3 | Regulated Protein | [2] | ||
| Ezrin | Regulated Protein | [7] | |||
| Growth arrest-specific protein 1 | Regulated Protein | [8] | |||
| Nuclear factor of activated T-cells, cytoplasmic 2 | Regulated Protein | [9] | |||
| Phosphatidylinositol 3,4,5-trisphosphate 5-phosphatase 2 | Regulated Protein | [10] | |||
| Phosphatidylinositol 3,4,5-trisphosphate 5-phosphatase 2 | Regulated Protein | [11] | |||
| Phospholipid phosphatase 3 | Regulated Protein | [3] | |||
| Protein argonaute-2 | Regulated Protein | [13] | |||
| RelA-associated inhibitor | Regulated Protein | [14] | |||
| Staphylococcal nuclease domain-containing protein 1 | Regulated Protein | [15] | |||
| Transcription factor SOX-7 | Regulated Protein | [16] | |||
| Tumor necrosis factor alpha-induced protein 2 | Regulated Protein | [17] | |||
| Zinc finger protein ZFPM2 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | Tumor suppressor PDCD4 modulates miR-184-mediated direct suppression of C-MYC and BCL2 blocking cell growth and survival in nasopharyngeal carcinoma. Cell Death Dis. 2013 Oct 24;4:e872. | ||||
| REF 2 | Differential expression of miR-184 in temporal lobe epilepsy patients with and without hippocampal sclerosis - Influence on microglial function. Sci Rep. 2016 Sep 26;6:33943. | ||||
| REF 3 | miR-184 exhibits angiostatic properties via regulation of Akt and VEGF signaling pathways. FASEB J. 2017 Jan;31(1):256-265. | ||||
| REF 4 | c-Myc modulates glucose metabolism via regulation of miR-184/PKM2 pathway in clear-cell renal cell carcinoma. Int J Oncol. 2016 Oct;49(4):1569-75. | ||||
| REF 5 | Downregulation of miR-21 inhibits EGFR pathway and suppresses the growth of human glioblastoma cells independent of PTEN status. Lab Invest. 2010 Feb;90(2):144-55. | ||||
| REF 6 | Differential expression of miR-184 in temporal lobe epilepsy patients with and without hippocampal sclerosis - Influence on microglial function. Sci Rep. 2016 Sep 26;6:33943. | ||||
| REF 7 | miR-184 regulates ezrin, LAMP-1 expression, affects phagocytosis in human retinal pigment epithelium and is downregulated in age-related macular degeneration.FEBS J. 2014 Dec;281(23):5251-64. | ||||
| REF 8 | MiR-184 Regulates Proliferation in Nucleus Pulposus Cells by Targeting GAS1.World Neurosurg. 2017 Jan;97:710-715.e1. | ||||
| REF 9 | microRNA 184 regulates expression of NFAT1 in umbilical cord blood CD4+ T cells.Blood. 2009 Jun 25;113(26):6648-57. | ||||
| REF 10 | MicroRNA-184 antagonizes microRNA-205 to maintain SHIP2 levels in epithelia.Proc Natl Acad Sci U S A. 2008 Dec 9;105(49):19300-5. | ||||
| REF 11 | miR-184 functions as an oncogenic regulator in hepatocellular carcinoma (HCC).Biomed Pharmacother. 2014 Mar;68(2):143-8. | ||||
| REF 12 | miR-184 exhibits angiostatic properties via regulation of Akt and VEGF signaling pathways. FASEB J. 2017 Jan;31(1):256-265. | ||||
| REF 13 | Argonaute2 mediates compensatory expansion of the pancreatic cell.Cell Metab. 2014 Jan 7;19(1):122-34. | ||||
| REF 14 | MicroRNA-184 Modulates Human Central Nervous System Lymphoma Cells Growth and Invasion by Targeting iASPP.J Cell Biochem. 2017 Sep;118(9):2645-2653. | ||||
| REF 15 | Suppression of miR-184 in malignant gliomas upregulates SND1 and promotes tumor aggressiveness.Neuro Oncol. 2015 Mar;17(3):419-29. | ||||
| REF 16 | Mir-184 post-transcriptionally regulates SOX7 expression and promotes cell proliferation in human hepatocellular carcinoma.PLoS One. 2014 Feb 18;9(2):e88796. | ||||
| REF 17 | MicroRNA-184 inhibits cell proliferation and invasion, and specifically targets TNFAIP2 in Glioma.J Exp Clin Cancer Res. 2015 Mar 26;34:27. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.