miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-18b-5p | ||||
| miRNA Stemloop AC | MI0001518 | ||||
| miRNA Stemloop ID | hsa-mir-18b | ||||
| Sequence | uaaggugcaucuagugcaguuag | ||||
| TTD Target(s) Regulated by This miRNA | Estrogen receptor (ESR) | Successful Target | Target Info | [1] | |
| Ubiquitin-protein ligase E3 Mdm2 (MDM2) | Clinical trial Target | Target Info | [2] | ||
| Connective tissue growth factor (CTGF) | Clinical trial Target | Target Info | [3] | ||
| Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [4] | ||
| Insulin-like growth factor-I (IGF1) | Clinical trial Target | Target Info | [5] | ||
| Protein(s) Regulated by This miRNA | Forkhead box protein N1 | Regulated Protein | [6] | ||
| Mothers against decapentaplegic homolog 2 | Regulated Protein | [7] | |||
| Trinucleotide repeat-containing gene 6B protein | Regulated Protein | [8] | |||
| References | |||||
| REF 1 | Protein lysate microarray analysis to identify microRNAs regulating estrogen receptor signaling in breast cancer cell lines. Oncogene. 2009 Nov 5;28(44):3926-36. | ||||
| REF 2 | The role of miR-18b in MDM2-p53 pathway signaling and melanoma progression. J Natl Cancer Inst. 2013 Mar 20;105(6):433-42. | ||||
| REF 3 | Loss of connective tissue growth factor as an unfavorable prognosis factor activates miR-18b by PI3K/AKT/C-Jun and C-Myc and promotes cell growth in nasopharyngeal carcinoma. Cell Death Dis. 2013 May 16;4:e634. | ||||
| REF 4 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
| REF 5 | microRNA-18b modulates insulin-like growth factor-1 expression in deer antler cell proliferation by directly targeting its 3' untranslated region. DNA Cell Biol. 2015 Apr;34(4):282-9. | ||||
| REF 6 | miR-18b and miR-518b Target FOXN1 during epithelial lineage differentiation in pluripotent cells.Stem Cells Dev. 2014 May 15;23(10):1149-56. | ||||
| REF 7 | miR-18b inhibits TGF-1-induced differentiation of hair follicle stem cells into smooth muscle cells by targeting SMAD2.Biochem Biophys Res Commun. 2013 Aug 30;438(3):551-6. | ||||
| REF 8 | The expression level of miR-18b in hepatocellular carcinoma is associated with the grade of malignancy and prognosis.BMC Cancer. 2013 Mar 4;13:99. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.