miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-191-5p | ||||
| miRNA Stemloop AC | MI0000465 | ||||
| miRNA Stemloop ID | hsa-mir-191 | ||||
| Sequence | caacggaaucccaaaagcagcug | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | |
| Cyclin-dependent kinase 9 (CDK9) | Clinical trial Target | Target Info | [2] | ||
| Interleukin-1 alpha (IL1A) | Clinical trial Target | Target Info | [3] | ||
| Notch-2 receptor (NOTCH2) | Clinical trial Target | Target Info | [2] | ||
| Early growth response protein 1 (EGR-1) | Clinical trial Target | Target Info | [4] | ||
| Ribosomal protein S6 kinase alpha-3 (RSK3) | Patented-recorded Target | Target Info | [2] | ||
| CCAAT/enhancer binding protein beta (CEBPB) | Literature-reported Target | Target Info | [5] | ||
| Protein(s) Regulated by This miRNA | Bifunctional heparan sulfate N-deacetylase/N-sulfotransferase 1 | Regulated Protein | [6] | ||
| Brain acid soluble protein 1 | Regulated Protein | [7] | |||
| Carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 2 | Regulated Protein | [4] | |||
| DNA-binding protein SATB1 | Regulated Protein | [1] | |||
| G1/S-specific cyclin-D2 | Regulated Protein | [4] | |||
| Monocarboxylate transporter 8 | Regulated Protein | [4] | |||
| Protein Mdm4 | Regulated Protein | [10] | |||
| Transcription factor SOX-4 | Regulated Protein | [3] | |||
| Transmembrane channel-like protein 7 | Regulated Protein | [3] | |||
| Volume-regulated anion channel subunit LRRC8A | Regulated Protein | [4] | |||
| Y-box-binding protein 3 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | MicroRNA-191 triggers keratinocytes senescence by SATB1 and CDK6 downregulation. Biochem Biophys Res Commun. 2012 Jul 6;423(3):509-14. | ||||
| REF 2 | MiR-191 Regulates Primary Human Fibroblast Proliferation and Directly Targets Multiple Oncogenes. PLoS One. 2015 May 20;10(5):e0126535. | ||||
| REF 3 | hsa-miR-191 is a candidate oncogene target for hepatocellular carcinoma therapy. Cancer Res. 2010 Oct 15;70(20):8077-87. | ||||
| REF 4 | Estrogen mediated-activation of miR-191/425 cluster modulates tumorigenicity of breast cancer cells depending on estrogen receptor status. PLoS Genet. 2013;9(3):e1003311. | ||||
| REF 5 | PU.1 promotes miR-191 to inhibit adipogenesis in 3T3-L1 preadipocytes. Biochem Biophys Res Commun. 2014 Aug 22;451(2):329-33. | ||||
| REF 6 | MicroRNA-191 targets N-deacetylase/N-sulfotransferase 1 and promotes cell growth in human gastric carcinoma cell line MGC803.Acta Biochim Biophys Sin (Shanghai). 2011 Nov;43(11):849-56. | ||||
| REF 7 | MicroRNA-191, by promoting the EMT and increasing CSC-like properties, is involved in neoplastic and metastatic properties of transformed human bronchial epithelial cells.Mol Carcinog. 2015 Jun;54 Suppl 1:E148-61. | ||||
| REF 8 | Estrogen mediated-activation of miR-191/425 cluster modulates tumorigenicity of breast cancer cells depending on estrogen receptor status. PLoS Genet. 2013;9(3):e1003311. | ||||
| REF 9 | MicroRNA-191 triggers keratinocytes senescence by SATB1 and CDK6 downregulation. Biochem Biophys Res Commun. 2012 Jul 6;423(3):509-14. | ||||
| REF 10 | An illegitimate microRNA target site within the 3' UTR of MDM4 affects ovarian cancer progression and chemosensitivity.Cancer Res. 2010 Dec 1;70(23):9641-9. | ||||
| REF 11 | hsa-miR-191 is a candidate oncogene target for hepatocellular carcinoma therapy. Cancer Res. 2010 Oct 15;70(20):8077-87. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.