miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-192-5p | ||||
| miRNA Stemloop AC | MI0000234 | ||||
| miRNA Stemloop ID | hsa-mir-192 | ||||
| Sequence | cugaccuaugaauugacagcc | ||||
| TTD Target(s) Regulated by This miRNA | Estrogen receptor (ESR) | Successful Target | Target Info | [1] | |
| Histamine H1 receptor (H1R) | Successful Target | Target Info | [2] | ||
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [2] | ||
| Dihydrofolate reductase (DHFR) | Successful Target | Target Info | [3] | ||
| Voltage-gated sodium channel alpha Nav1.5 (SCN5A) | Successful Target | Target Info | [4] | ||
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [5] | ||
| Endothelial plasminogen activator inhibitor (SERPINE1) | Clinical trial Target | Target Info | [6] | ||
| Integrin alpha-V (ITGAV) | Clinical trial Target | Target Info | [2] | ||
| Integrin beta-1 (ITGB1) | Clinical trial Target | Target Info | [2] | ||
| Serine/threonine-protein kinase pim-1 (PIM1) | Clinical trial Target | Target Info | [2] | ||
| CDC7-related kinase (CDC7) | Clinical trial Target | Target Info | [2] | ||
| X-linked inhibitor of apoptosis protein (XIAP) | Clinical trial Target | Target Info | [2] | ||
| Leukocyte surface antigen CD47 (CD47) | Clinical trial Target | Target Info | [7] | ||
| Activin receptor type IIB (ACVR2B) | Literature-reported Target | Target Info | [2] | ||
| Activated leukocyte cell adhesionmolecule (ALCAM) | Clinical trial Target | Target Info | [8] | ||
| Integrin beta-3 (ITGB3) | Literature-reported Target | Target Info | [7] | ||
| Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [9] | ||
| Caveolin 1 (CAV1) | Literature-reported Target | Target Info | [10] | ||
| CDK inhibitor 1B p27Kip1 (CDKN1B) | Literature-reported Target | Target Info | [11] | ||
| Kinesin-like protein KIF20B (MPHOSPH1) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Cullin-5 | Regulated Protein | [2] | ||
| Denticleless protein homolog | Regulated Protein | [2] | |||
| Disks large homolog 5 | Regulated Protein | [2] | |||
| DNA repair endonuclease XPF | Regulated Protein | [13] | |||
| General transcription and DNA repair factor IIH helicase subunit XPB | Regulated Protein | [2] | |||
| Histone H3.3 | Regulated Protein | [14] | |||
| Homeobox protein Hox-A10 | Regulated Protein | [2] | |||
| Lamin-B2 | Regulated Protein | [2] | |||
| Mitotic spindle assembly checkpoint protein MAD2A | Regulated Protein | [2] | |||
| Nidogen-1 | Regulated Protein | [15] | |||
| Pre-mRNA-splicing factor 38A | Regulated Protein | [2] | |||
| Protein MCM10 homolog | Regulated Protein | [2] | |||
| Rac GTPase-activating protein 1 | Regulated Protein | [2] | |||
| Retinoblastoma-associated protein | Regulated Protein | [16] | |||
| RNA-binding protein NOB1 | Regulated Protein | [17] | |||
| Septin-10 | Regulated Protein | [2] | |||
| Serine/threonine-protein kinase WNK1 | Regulated Protein | [18] | |||
| Sodium/potassium-transporting ATPase subunit beta-1 | Regulated Protein | [19] | |||
| SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1 | Regulated Protein | [2] | |||
| Trafficking protein particle complex subunit 2B | Regulated Protein | [20] | |||
| References | |||||
| REF 1 | miRNAs involved in LY6K and estrogen receptor contribute to tamoxifen-susceptibility in breast cancer. Oncotarget. 2016 Jul 5;7(27):42261-42273. | ||||
| REF 2 | Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12. | ||||
| REF 3 | A miR-24 microRNA binding-site polymorphism in dihydrofolate reductase gene leads to methotrexate resistance. Proc Natl Acad Sci U S A. 2007 Aug 14;104(33):13513-8. | ||||
| REF 4 | Post-transcriptional regulation of cardiac sodium channel gene SCN5A expression and function by miR-192-5p. Biochim Biophys Acta. 2015 Oct;1852(10 Pt A):2024-34. | ||||
| REF 5 | Curcumin inhibits cell proliferation and induces apoptosis of human non-small cell lung cancer cells through the upregulation of miR-192-5p and suppression of PI3K/Akt signaling pathway. Oncol Rep. 2015 Nov;34(5):2782-9. | ||||
| REF 6 | Early Epigenetic Downregulation of microRNA-192 Expression Promotes Pancreatic Cancer Progression. Cancer Res. 2016 Jul 15;76(14):4149-59. | ||||
| REF 7 | miR-192 suppresses leptomeningeal dissemination of medulloblastoma by modulating cell proliferation and anchoring through the regulation of DHFR, integrins, and CD47. Oncotarget. 2015 Dec 22;6(41):43712-30. | ||||
| REF 8 | A limited set of human MicroRNA is deregulated in follicular thyroid carcinoma. J Clin Endocrinol Metab. 2006 Sep;91(9):3584-91. | ||||
| REF 9 | Negative regulation of Bmi-1 by AMPK and implication in cancer progression. Oncotarget. 2016 Feb 2;7(5):6188-200. | ||||
| REF 10 | Docosahexaenoic acid modulates the enterocyte Caco-2 cell expression of microRNAs involved in lipid metabolism. J Nutr. 2014 May;144(5):575-85. | ||||
| REF 11 | Regulation of the p27(Kip1) tumor suppressor by miR-221 and miR-222 promotes cancer cell proliferation. EMBO J. 2007 Aug 8;26(15):3699-708. | ||||
| REF 12 | Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12. | ||||
| REF 13 | MiR-192 inhibits nucleotide excision repair by targeting ERCC3 and ERCC4 in HepG2.2.15 cells.Biochem Biophys Res Commun. 2011 Jul 8;410(3):440-5. | ||||
| REF 14 | Regulation of hepatic microRNA expression by hepatocyte nuclear factor 4 alpha.World J Hepatol. 2017 Feb 8;9(4):191-208. | ||||
| REF 15 | Nidogen-1 is a common target of microRNAs MiR-192/215 in the pathogenesis of Hirschsprung's disease.J Neurochem. 2015 Jul;134(1):39-46. | ||||
| REF 16 | MicroRNA-192 targeting retinoblastoma 1 inhibits cell proliferation and induces cell apoptosis in lung cancer cells.Nucleic Acids Res. 2011 Aug;39(15):6669-78. | ||||
| REF 17 | MiR-192 suppresses the tumorigenicity of prostate cancer cells by targeting and inhibiting nin one binding protein.Int J Mol Med. 2016 Feb;37(2):485-92. | ||||
| REF 18 | Regulation of WNK1 expression by miR-192 and aldosterone.J Am Soc Nephrol. 2010 Oct;21(10):1724-31. | ||||
| REF 19 | MicroRNAs contribute to the maintenance of cell-type-specific physiological characteristics: miR-192 targets Na+/K+-ATPase 1.Nucleic Acids Res. 2013 Jan;41(2):1273-83. | ||||
| REF 20 | MicroRNAs are differentially expressed in ulcerative colitis and alter expression of macrophage inflammatory peptide-2 alpha.Gastroenterology. 2008 Nov;135(5):1624-1635.e24. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.