miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-195-5p
miRNA Stemloop AC MI0000489
miRNA Stemloop ID hsa-mir-195
Sequence uagcagcacagaaauauuggc
TTD Target(s) Regulated by This miRNA Insulin receptor (INSR) Successful Target Target Info [1]
Proto-oncogene c-Ret (RET) Successful Target Target Info [2]
Vascular endothelial growth factor receptor 2 (KDR) Successful Target Target Info [3]
Cyclin-dependent kinase 4 (CDK4) Successful Target Target Info [4]
Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [5]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [6]
Fatty acid synthase (FASN) Successful Target Target Info [7]
Fibroblast growth factor-2 (FGF2) Successful Target Target Info [7]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [8]
Checkpoint kinase-1 (CHK1) Clinical trial Target Target Info [9]
Ribosomal protein S6 kinase beta-1 (S6K1) Clinical trial Target Target Info [10]
Wee1-like protein kinase (WEE1) Clinical trial Target Target Info [11]
Apoptosis inhibitor survivin (BIRC5) Clinical trial Target Target Info [12]
Apoptosis regulator Bcl-W (BCL-W) Clinical trial Target Target Info [13]
Beta-secretase 1 (BACE1) Clinical trial Target Target Info [14]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [15]
Proto-oncogene c-RAF (c-RAF) Clinical trial Target Target Info [16]
Cyclin-dependent kinase 8 (CDK8) Clinical trial Target Target Info [17]
Arachidonate 12-lipoxygenase (12-LOX) Literature-reported Target Target Info [18]
M-phase inducer phosphatase 1 (MPIP1) Literature-reported Target Target Info [9]
Inhibitor of nuclear factor kappa-B kinase alpha (IKKA) Literature-reported Target Target Info [19]
G1/S-specific cyclin-E1 (CCNE1) Literature-reported Target Target Info [7]
ADP-ribosylation factor-like protein 2 (ARL2) Literature-reported Target Target Info [20]
Cyclin D (CCND3) Literature-reported Target Target Info [21]
High mobility group protein HMG-I/Y (HMGA1) Literature-reported Target Target Info [22]
Methyl cpg binding protein 2 (MECP2) Clinical trial Target Target Info [23]
Wnt-7a protein (WNT7A) Literature-reported Target Target Info [12]
Yes-associated protein 1 (YAP1) Literature-reported Target Target Info [24]
Runt-related transcription factor 2 (RUNX2) Literature-reported Target Target Info [16]
Protein(s) Regulated by This miRNA Bcl-2-like protein 11 Regulated Protein
B2L11_HUMAN
[23]
Beclin 1-associated autophagy-related key regulator Regulated Protein
BAKOR_HUMAN
[26]
C-C motif chemokine 4 Regulated Protein
CCL4_HUMAN
[27]
Calcium-binding protein 39 Regulated Protein
CAB39_HUMAN
[28]
Cdc42-interacting protein 4 Regulated Protein
CIP4_HUMAN
[18]
Cell division control protein 42 homolog Regulated Protein
CDC42_HUMAN
[30]
Cingulin-like protein 1 Regulated Protein
CGNL1_HUMAN
[18]
E3 SUMO-protein ligase CBX4 Regulated Protein
CBX4_HUMAN
[31]
Elastin Regulated Protein
ELN_HUMAN
[32]
F-box/WD repeat-containing protein 1A Regulated Protein
FBW1A_HUMAN
[33]
Keratin, type II cytoskeletal 7 Regulated Protein
K2C7_HUMAN
[34]
Kinesin-like protein KIF21A Regulated Protein
KI21A_HUMAN
[18]
Methyl-CpG-binding domain protein 1 Regulated Protein
MBD1_HUMAN
[35]
Phosphatase and actin regulator 2 Regulated Protein
PHAR2_HUMAN
[18]
Protein disulfide-isomerase A6 Regulated Protein
PDIA6_HUMAN
[18]
Protein KIAA0100 Regulated Protein
K0100_HUMAN
[36]
Protein naked cuticle homolog 1 Regulated Protein
NKD1_HUMAN
[37]
Ras-GEF domain-containing family member 1B Regulated Protein
RGF1B_HUMAN
[18]
Ski oncogene Regulated Protein
SKI_HUMAN
[23]
Solute carrier family 2, facilitated glucose transporter member 3 Regulated Protein
GTR3_HUMAN
[38]
Sorting nexin-16 Regulated Protein
SNX16_HUMAN
[18]
STE20-related kinase adapter protein beta Regulated Protein
STRAB_HUMAN
[18]
TBCC domain-containing protein 1 Regulated Protein
TBCC1_HUMAN
[21]
TGF-beta-activated kinase 1 and MAP3K7-binding protein 3 Regulated Protein
TAB3_HUMAN
[19]
Tuftelin Regulated Protein
TUFT1_HUMAN
[18]
References
REF 1 Saturated fatty acid-induced miR-195 impairs insulin signaling and glycogen metabolism in HepG2 cells. FEBS Lett. 2014 Nov 3;588(21):3939-46.
REF 2 Acute myeloid leukemia with translocation (8;16)(p11;p13) and MYST3-CREBBP rearrangement harbors a distinctive microRNA signature targeting RET proto-oncogene. Leukemia. 2013 Mar;27(3):595-603.
REF 3 MicroRNA-195 targets VEGFR2 and has a tumor suppressive role in ACHN cells via PI3K/Akt and Raf/MEK/ERK signaling pathways. Int J Oncol. 2016 Sep;49(3):1155-63.
REF 4 Cyclin-dependent kinase 4 is a novel target in micoRNA-195-mediated cell cycle arrest in bladder cancer cells. FEBS Lett. 2012 Feb 17;586(4):442-7.
REF 5 Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
REF 6 microRNA-195 promotes apoptosis and suppresses tumorigenicity of human colorectal cancer cells. Biochem Biophys Res Commun. 2010 Sep 17;400(2):236-40.
REF 7 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 8 The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 9 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 10 miR-195 Inhibits Tumor Progression by Targeting RPS6KB1 in Human Prostate Cancer. Clin Cancer Res. 2015 Nov 1;21(21):4922-34.
REF 11 microRNAs regulate human embryonic stem cell division. Cell Cycle. 2009 Nov 15;8(22):3729-41.
REF 12 The microRNA expression signature of bladder cancer by deep sequencing: the functional significance of the miR-195/497 cluster. PLoS One. 2014 Feb 10;9(2):e84311.
REF 13 MicroRNA-195 chemosensitizes colon cancer cells to the chemotherapeutic drug doxorubicin by targeting the first binding site of BCL2L2 mRNA. J Cell Physiol. 2015 Mar;230(3):535-45.
REF 14 MicroRNA-195 protects against dementia induced by chronic brain hypoperfusion via its anti-amyloidogenic effect in rats. J Neurosci. 2013 Feb 27;33(9):3989-4001.
REF 15 MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57.
REF 16 Analysis of MiR-195 and MiR-497 expression, regulation and role in breast cancer. Clin Cancer Res. 2011 Apr 1;17(7):1722-30.
REF 17 Tumor-suppressive microRNA-195-5p regulates cell growth and inhibits cell cycle by targeting cyclin dependent kinase 8 in colon cancer. Am J Transl Res. 2016 May 15;8(5):2088-96.
REF 18 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 19 Genome-wide screening reveals that miR-195 targets the TNF-/NF-B pathway by down-regulating IB kinase alpha and TAB3 in hepatocellular carcinoma. Hepatology. 2013 Aug;58(2):654-66.
REF 20 MicroRNA-195 targets ADP-ribosylation factor-like protein 2 to induce apoptosis in human embryonic stem cell-derived neural progenitor cells. Cell Death Dis. 2013 Jun 27;4:e695.
REF 21 MicroRNA-195 plays a tumor-suppressor role in human glioblastoma cells by targeting signaling pathways involved in cellular proliferation and invasion. Neuro Oncol. 2012 Mar;14(3):278-87.
REF 22 Downregulation of miR-195 promotes prostate cancer progression by targeting HMGA1. Oncol Rep. 2016 Jul;36(1):376-82.
REF 23 Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45.
REF 24 Integrated analysis identifies microRNA-195 as a suppressor of Hippo-YAP pathway in colorectal cancer. J Hematol Oncol. 2017 Mar 29;10(1):79.
REF 25 Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45.
REF 26 Increased miR-195 aggravates neuropathic pain by inhibiting autophagy following peripheral nerve injury.Glia. 2013 Apr;61(4):504-12.
REF 27 Endothelin-1-induced macrophage inflammatory protein-1beta expression in monocytic cells involves hypoxia-inducible factor-1alpha and AP-1 and is negatively regulated by microRNA-195.J Immunol. 2010 Nov 15;185(10):6253-64.
REF 28 Micro-RNA-195 and -451 regulate the LKB1/AMPK signaling axis by targeting MO25.PLoS One. 2012;7(7):e41574.
REF 29 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 30 MicroRNA-195 regulates vascular smooth muscle cell phenotype and prevents neointimal formation.Cardiovasc Res. 2012 Sep 1;95(4):517-26.
REF 31 MicroRNA-195 functions as a tumor suppressor by inhibiting CBX4 in hepatocellular carcinoma.Oncol Rep. 2015 Mar;33(3):1115-22.
REF 32 Role of miR-195 in aortic aneurysmal disease.Circ Res. 2014 Oct 24;115(10):857-66.
REF 33 The tumor-suppressive miR-497-195 cluster targets multiple cell-cycle regulators in hepatocellular carcinoma. PLoS One. 2013;8(3):e60155.
REF 34 Identification of novel microRNA targets based on microRNA signatures in bladder cancer.Int J Cancer. 2009 Jul 15;125(2):345-52.
REF 35 An epigenetic feedback regulatory loop involving microRNA-195 and MBD1 governs neural stem cell differentiation.PLoS One. 2013;8(1):e51436.
REF 36 MicroRNA-195 suppresses tumor cell proliferation and metastasis by directly targeting BCOX1 in prostate carcinoma.J Exp Clin Cancer Res. 2015 Sep 4;34:91.
REF 37 MicroRNA-195-5p suppresses osteosarcoma cell proliferation and invasion by suppressing naked cuticle homolog 1.Cell Biol Int. 2017 Mar;41(3):287-295.
REF 38 MicroRNA-195-5p suppresses glucose uptake and proliferation of human bladder cancer T24 cells by regulating GLUT3 expression.FEBS Lett. 2012 Feb 17;586(4):392-7.
REF 39 MicroRNA-195 plays a tumor-suppressor role in human glioblastoma cells by targeting signaling pathways involved in cellular proliferation and invasion. Neuro Oncol. 2012 Mar;14(3):278-87.
REF 40 Genome-wide screening reveals that miR-195 targets the TNF-/NF-B pathway by down-regulating IB kinase alpha and TAB3 in hepatocellular carcinoma. Hepatology. 2013 Aug;58(2):654-66.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.