miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-196a-5p
miRNA Stemloop AC MI0000238 | MI0000279
miRNA Stemloop ID hsa-mir-196a-1 | hsa-mir-196a-2
Sequence uagguaguuucauguuguuggg
TTD Target(s) Regulated by This miRNA Inhibitor of nuclear factor kappa-B kinase beta (IKKB) Clinical trial Target Target Info [1]
Calgranulin B (S100A9) Clinical trial Target Target Info [2]
Homeobox protein Hox-A7 (HOXA7) Literature-reported Target Target Info [3]
Protein(s) Regulated by This miRNA Annexin A1 Regulated Protein
ANXA1_HUMAN
[4]
Elongation of very long chain fatty acids protein 1 Regulated Protein
ELOV1_HUMAN
[5]
Homeobox protein Hox-A10 Regulated Protein
HXA10_HUMAN
[6]
Homeobox protein Hox-B7 Regulated Protein
HXB7_HUMAN
[7]
Homeobox protein Hox-B8 Regulated Protein
HXB8_HUMAN
[8]
Homeobox protein Hox-C8 Regulated Protein
HXC8_HUMAN
[9]
Homeobox protein Hox-D8 Regulated Protein
HXD8_HUMAN
[8]
Keratin, type II cytoskeletal 5 Regulated Protein
K2C5_HUMAN
[2]
Lethal(2) giant larvae protein homolog 1 Regulated Protein
L2GL1_HUMAN
[11]
Lymphocyte-specific protein 1 Regulated Protein
LSP1_HUMAN
[12]
MAM domain-containing protein 2 Regulated Protein
MAMC2_HUMAN
[13]
Netrin-4 Regulated Protein
NET4_HUMAN
[14]
NF-kappa-B inhibitor alpha Regulated Protein
IKBA_HUMAN
[15]
Radixin Regulated Protein
RADI_HUMAN
[16]
Sjoegren syndrome/scleroderma autoantigen 1 Regulated Protein
SSA27_HUMAN
[17]
References
REF 1 Regulation of IKKbeta by miR-199a affects NF-kappaB activity in ovarian cancer cells. Oncogene. 2008 Aug 7;27(34):4712-23.
REF 2 MicroRNA-196a is a potential marker of progression during Barrett's metaplasia-dysplasia-invasive adenocarcinoma sequence in esophagus. Am J Pathol. 2009 May;174(5):1940-8.
REF 3 MicroRNA-directed cleavage of HOXB8 mRNA. Science. 2004 Apr 23;304(5670):594-6.
REF 4 MicroRNA-196a targets annexin A1: a microRNA-mediated mechanism of annexin A1 downregulation in cancers.Oncogene. 2008 Nov 6;27(52):6667-78.
REF 5 MicroRNA Profiling Identifies miR-196a as Differentially Expressed in Childhood Adrenoleukodystrophy and Adult Adrenomyeloneuropathy.Mol Neurobiol. 2017 Mar;54(2):1392-1403.
REF 6 Expression and mechanism of action of miR-196a in epithelial ovarian cancer.Asian Pac J Trop Med. 2016 Nov;9(11):1105-1110.
REF 7 MicroRNA miR-196a is a central regulator of HOX-B7 and BMP4 expression in malignant melanoma.Cell Mol Life Sci. 2010 Oct;67(20):3535-48.
REF 8 High miR-196a levels promote the oncogenic phenotype of colorectal cancer cells.World J Gastroenterol. 2009 May 7;15(17):2089-96.
REF 9 miR-196a regulates proliferation and osteogenic differentiation in mesenchymal stem cells derived from human adipose tissue.J Bone Miner Res. 2009 May;24(5):816-25.
REF 10 MicroRNA-196a is a potential marker of progression during Barrett's metaplasia-dysplasia-invasive adenocarcinoma sequence in esophagus. Am J Pathol. 2009 May;174(5):1940-8.
REF 11 MicroRNA miR-196a controls melanoma-associated genes by regulating HOX-C8 expression.Int J Cancer. 2011 Sep 1;129(5):1064-74.
REF 12 Genetic variations in microRNAs and the risk and survival of renal cell cancer.Carcinogenesis. 2014 Jul;35(7):1629-35.
REF 13 The role of HOXB9 and miR-196a in head and neck squamous cell carcinoma.PLoS One. 2015 Apr 10;10(4):e0122285.
REF 14 miR-196a targets netrin 4 and regulates cell proliferation and migration of cervical cancer cells.Biochem Biophys Res Commun. 2013 Nov 1;440(4):582-8.
REF 15 MiR-196a promotes pancreatic cancer progression by targeting nuclear factor kappa-B-inhibitor alpha.PLoS One. 2014 Feb 4;9(2):e87897.
REF 16 MicroRNA-196a/-196b promote cell metastasis via negative regulation of radixin in human gastric cancer.Cancer Lett. 2014 Sep 1;351(2):222-31.
REF 17 Upregulation of MiR-196a promotes cell proliferation by downregulating p27kip1 in laryngeal cancer.Biol Res. 2016 Sep 27;49(1):40.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.