miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-196b-5p | ||||
| miRNA Stemloop AC | MI0001150 | ||||
| miRNA Stemloop ID | hsa-mir-196b | ||||
| Sequence | uagguaguuuccuguuguuggg | ||||
| TTD Target(s) Regulated by This miRNA | Serine/threonine-protein kinase mTOR (mTOR) | Successful Target | Target Info | [1] | |
| PI3-kinase gamma (PIK3CG) | Successful Target | Target Info | [1] | ||
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [2] | ||
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [1] | ||
| Apoptosis mediating surface antigen FAS (FAS) | Clinical trial Target | Target Info | [3] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [4] | ||
| Proto-oncogene c-Fos (c-Fos) | Literature-reported Target | Target Info | [5] | ||
| Protein(s) Regulated by This miRNA | Homeobox protein Hox-A10 | Regulated Protein | [6] | ||
| Homeobox protein Hox-A9 | Regulated Protein | [7] | |||
| Homeobox protein Hox-B7 | Regulated Protein | [8] | |||
| Homeobox protein Hox-B8 | Regulated Protein | [9] | |||
| Homeobox protein Hox-C8 | Regulated Protein | [10] | |||
| Homeobox protein Meis1 | Regulated Protein | [7] | |||
| Insulin-like growth factor 2 mRNA-binding protein 1 | Regulated Protein | [11] | |||
| Protein C-ets-2 | Regulated Protein | [12] | |||
| Radixin | Regulated Protein | [13] | |||
| T-cell surface glycoprotein CD8 alpha chain | Regulated Protein | [14] | |||
| Transcription factor GATA-6 | Regulated Protein | [15] | |||
| References | |||||
| REF 1 | miR-196b regulates gastric cancer cell proliferation and invasion via PI3K/AKT/mTOR signaling pathway. Oncol Lett. 2016 Mar;11(3):1745-1749. | ||||
| REF 2 | miR-196b targets c-myc and Bcl-2 expression, inhibits proliferation and induces apoptosis in endometriotic stromal cells. Hum Reprod. 2013 Mar;28(3):750-61. | ||||
| REF 3 | MicroRNA 196B regulates FAS-mediated apoptosis in colorectal cancer cells. Oncotarget. 2015 Feb 20;6(5):2843-55. | ||||
| REF 4 | MicroRNA-196a/b Mitigate Renal Fibrosis by Targeting TGF- Receptor 2. J Am Soc Nephrol. 2016 Oct;27(10):3006-3021. | ||||
| REF 5 | miR-196b Is Epigenetically Silenced during the Premalignant Stage of Lung Carcinogenesis. Cancer Res. 2016 Aug 15;76(16):4741-51. | ||||
| REF 6 | Overexpression of miR-196b and HOXA10 characterize a poor-prognosis gastric cancer subtype.World J Gastroenterol. 2013 Nov 7;19(41):7078-88. | ||||
| REF 7 | miR-196b directly targets both HOXA9/MEIS1 oncogenes and FAS tumour suppressor in MLL-rearranged leukaemia. Nat Commun. 2012 Feb 21;3:688. | ||||
| REF 8 | MicroRNA-196b regulates the homeobox B7-vascular endothelial growth factor axis in cervical cancer.PLoS One. 2013 Jul 4;8(7):e67846. | ||||
| REF 9 | Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.PLoS One. 2008 May 21;3(5):e2248. | ||||
| REF 10 | Ratio of miR-196s to HOXC8 messenger RNA correlates with breast cancer cell migration and metastasis.Cancer Res. 2010 Oct 15;70(20):7894-904. | ||||
| REF 11 | miRNA-196b inhibits cell proliferation and induces apoptosis in HepG2 cells by targeting IGF2BP1.Mol Cancer. 2015 Apr 8;14:79. | ||||
| REF 12 | Transcriptional regulation of miR-196b by ETS2 in gastric cancer cells.Carcinogenesis. 2012 Apr;33(4):760-9. | ||||
| REF 13 | MicroRNA-196a/-196b promote cell metastasis via negative regulation of radixin in human gastric cancer.Cancer Lett. 2014 Sep 1;351(2):222-31. | ||||
| REF 14 | T cell post-transcriptional miRNA-mRNA interaction networks identify targets associated with susceptibility/resistance to collagen-induced arthritis. PLoS One. 2013;8(1):e54803. | ||||
| REF 15 | The miR-196b miRNA inhibits the GATA6 intestinal transcription factor and is upregulated in colon cancer patients.Oncotarget. 2017 Jan 17;8(3):4747-4759. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.