miRNA General Information
miRNA Mature ID hsa-miR-19a-3p
miRNA Stemloop AC MI0000073
miRNA Stemloop ID hsa-mir-19a
Sequence ugugcaaaucuaugcaaaacuga
TTD Target(s) Regulated by This miRNA Arachidonate 5-lipoxygenase (5-LOX) Successful Target Target Info [1]
Erbb4 tyrosine kinase receptor (Erbb-4) Successful Target Target Info [2]
Estrogen receptor (ESR) Successful Target Target Info [3]
Tyrosine-protein kinase Kit (KIT) Successful Target Target Info [4]
PI3-kinase alpha (PIK3CA) Successful Target Target Info [5]
ATP-binding cassette transporter A1 (ABCA1) Successful Target Target Info [6]
B-cell receptor CD22 (CD22) Successful Target Target Info [7]
Tumor necrosis factor (TNF) Successful Target Target Info [8]
Adrenergic receptor beta-1 (ADRB1) Successful Target Target Info [9]
Toll-like receptor 7 (TLR7) Successful Target Target Info [10]
Dihydropyrimidinase related protein 2 (DPYSL2) Successful Target Target Info [11]
RAC-alpha serine/threonine-protein kinase (AKT1) Clinical trial Target Target Info [12]
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Clinical trial Target Target Info [13]
Apoptosis signal-regulating kinase 1 (MAP3K5) Clinical trial Target Target Info [14]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [15]
Interleukin-10 (IL10) Clinical trial Target Target Info [16]
TGF-beta receptor type II (TGFBR2) Clinical trial Target Target Info [17]
TNF superfamily receptor 12A (TNFRSF12A) Clinical trial Target Target Info [18]
Toll-like receptor 2 (TLR2) Clinical trial Target Target Info [19]
Protein arginine methyltransferase 5 (PRMT5) Clinical trial Target Target Info [20]
Transferrin (TF) Clinical trial Target Target Info [21]
Thrombospondin-1 (THBS1) Clinical trial Target Target Info [22]
Tumor suppressor candidate 2 (TUSC2) Clinical trial Target Target Info [23]
Bone morphogenetic protein receptor (BMPR2) Literature-reported Target Target Info [24]
Histone acetyltransferase KAT2B (KAT2B) Literature-reported Target Target Info [24]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [25]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [26]
Zinc finger protein A20 (TNFAIP3) Literature-reported Target Target Info [18]
Orphan nuclear receptor NURR1 (NR4A2) Literature-reported Target Target Info [2]
Homeobox protein Hox-A5 (HOXA5) Literature-reported Target Target Info [25]
Methyl cpg binding protein 2 (MECP2) Literature-reported Target Target Info [25]
N-myc proto-oncogene protein (MYCN) Literature-reported Target Target Info [25]
Suppressor of cytokine signaling 1 (SOCS1) Literature-reported Target Target Info [24]
Suppressor of cytokine signaling 3 (SOCS3) Literature-reported Target Target Info [18]
Protein(s) Regulated by This miRNA Apoptosis regulatory protein Siva Regulated Protein [23]
Ataxin-1 Regulated Protein [28]
Bcl-2-like protein 11 Regulated Protein [24]
Cullin-5 Regulated Protein [30]
E3 ubiquitin-protein ligase ARIH2 Regulated Protein [31]
Forkhead box protein P1 Regulated Protein [23]
Homeobox protein PKNOX1 Regulated Protein [32]
Max dimerization protein 1 Regulated Protein [33]
Methylsterol monooxygenase 1 Regulated Protein [6]
Microtubule-associated tumor suppressor 1 Regulated Protein [35]
Mothers against decapentaplegic homolog 4 Regulated Protein [36]
Myocyte-specific enhancer factor 2D Regulated Protein [37]
PH domain leucine-rich repeat-containing protein phosphatase 1 Regulated Protein [38]
Polycomb protein SUZ12 Regulated Protein [6]
Probable aminopeptidase NPEPL1 Regulated Protein [39]
Prosaposin Regulated Protein [6]
Protein TMEPAI Regulated Protein [40]
Ras-related protein Rab-13 Regulated Protein [6]
Ras-related protein Rab-14 Regulated Protein [41]
Rho-related GTP-binding protein RhoB Regulated Protein [42]
Tumor protein p53-inducible nuclear protein 1 Regulated Protein [23]
Vacuolar protein sorting-associated protein 4B Regulated Protein [25]
Zinc finger and BTB domain-containing protein 4 Regulated Protein [44]
References
REF 1 5-lipoxygenase is a direct target of miR-19a-3p and miR-125b-5p. J Immunol. 2015 Feb 15;194(4):1646-53.
REF 2 Identification of microRNAs regulated by activin A in human embryonic stem cells. J Cell Biochem. 2010 Jan 1;109(1):93-102.
REF 3 The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47.
REF 4 Integrative nucleophosmin mutation-associated microRNA and gene expression pattern analysis identifies novel microRNA - target gene interactions in acute myeloid leukemia. Haematologica. 2011 Dec;96(12):1783-91.
REF 5 Downregulation of miR-19a exhibits inhibitory effects on metastatic renal cell carcinoma by targeting PIK3CA and inactivating Notch signaling in vitro. Oncol Rep. 2015 Aug;34(2):739-46.
REF 6 Identification of novel AR-targeted microRNAs mediating androgen signalling through critical pathways to regulate cell viability in prostate cancer. PLoS One. 2013;8(2):e56592.
REF 7 The Myc-miR-17-92 axis amplifies B-cell receptor signaling via inhibition of ITIM proteins: a novel lymphomagenic feed-forward loop. Blood. 2013 Dec 19;122(26):4220-9.
REF 8 TNF- is a novel target of miR-19a. Int J Oncol. 2011 Apr;38(4):1013-22.
REF 9 MiR-19a overexpression contributes to heart failure through targeting ADRB1. Int J Clin Exp Med. 2015 Jan 15;8(1):642-9.
REF 10 Microenvironmental interleukin-6 suppresses toll-like receptor signaling in human leukemia cells through miR-17/19A. Blood. 2015 Aug 6;126(6):766-78.
REF 11 Tumour-suppressor microRNAs let-7 and mir-101 target the proto-oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastoma. Br J Cancer. 2011 Jul 12;105(2):296-303.
REF 12 MiR-19a promotes epithelial-mesenchymal transition through PI3K/AKT pathway in gastric cancer. Int J Clin Exp Pathol. 2014 Sep 15;7(10):7286-96.
REF 13 Epigenetic regulation of miR-17~92 contributes to the pathogenesis of pulmonary fibrosis. Am J Respir Crit Care Med. 2013 Feb 15;187(4):397-405.
REF 14 MicroRNA-19a regulates lipopolysaccharide-induced endothelial cell apoptosis through modulation of apoptosis signal-regulating kinase 1 expression. BMC Mol Biol. 2015 May 16;16:11.
REF 15 MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57.
REF 16 Micro RNA-19a suppresses interleukin-10 in peripheral B cells of patients with diabetic retinopathy. Am J Transl Res. 2017 Mar 15;9(3):1410-1417.
REF 17 MYCN-regulated microRNAs repress estrogen receptor-alpha (ESR1) expression and neuronal differentiation in human neuroblastoma. Proc Natl Acad Sci U S A. 2010 Jan 26;107(4):1553-8.
REF 18 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 19 TLR2 expression is regulated by microRNA miR-19 in rheumatoid fibroblast-like synoviocytes. J Immunol. 2012 Jan 1;188(1):454-61.
REF 20 Protein arginine methyltransferase 5 suppresses the transcription of the RB family of tumor suppressors in leukemia and lymphoma cells. Mol Cell Biol. 2008 Oct;28(20):6262-77.
REF 21 MicroRNA-19a targets tissue factor to inhibit colon cancer cells migration and invasion. Mol Cell Biochem. 2013 Aug;380(1-2):239-47.
REF 22 Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
REF 23 Uncovering Direct Targets of MiR-19a Involved in Lung Cancer Progression. PLoS One. 2015 Sep 14;10(9):e0137887.
REF 24 MicroRNAs regulate critical genes associated with multiple myeloma pathogenesis. Proc Natl Acad Sci U S A. 2008 Sep 2;105(35):12885-90.
REF 25 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 26 Upregulation of the miR-17-92 cluster and its two paraloga in osteosarcoma - reasons and consequences. Genes Cancer. 2014 Apr;5(1-2):56-63.
REF 27 Uncovering Direct Targets of MiR-19a Involved in Lung Cancer Progression. PLoS One. 2015 Sep 14;10(9):e0137887.
REF 28 miR-19, miR-101 and miR-130 co-regulate ATXN1 levels to potentially modulate SCA1 pathogenesis.Nat Neurosci. 2008 Oct;11(10):1137-9.
REF 29 MicroRNAs regulate critical genes associated with multiple myeloma pathogenesis. Proc Natl Acad Sci U S A. 2008 Sep 2;105(35):12885-90.
REF 30 MicroRNA-19a and -19b regulate cervical carcinoma cell proliferation and invasion by targeting CUL5.Cancer Lett. 2012 Sep 28;322(2):148-58.
REF 31 Aberration of blastocyst microRNA expression is associated with human infertility.Fertil Steril. 2010 May 1;93(7):2374-82.
REF 32 The miR-17 2 cluster contributes to MLL leukemia through the repression of MEIS1 competitor PKNOX1.Leuk Res. 2016 Jul;46:51-60.
REF 33 MiR-19a/b modulate the metastasis of gastric cancer cells by targeting the tumour suppressor MXD1.Cell Death Dis. 2014 Mar 27;5:e1144.
REF 34 Identification of novel AR-targeted microRNAs mediating androgen signalling through critical pathways to regulate cell viability in prostate cancer. PLoS One. 2013;8(2):e56592.
REF 35 Oncogenic miR-19a and miR-19b co-regulate tumor suppressor MTUS1 to promote cell proliferation and migration in lung cancer.Protein Cell. 2017 Jun;8(6):455-466.
REF 36 The myc-miR-17~92 axis blunts TGF{beta} signaling and production of multiple TGF{beta}-dependent antiangiogenic factors. Cancer Res. 2010 Oct 15;70(20):8233-46.
REF 37 MEF2D/Wnt/-catenin pathway regulates the proliferation of gastric cancer cells and is regulated by microRNA-19.Tumour Biol. 2016 Jul;37(7):9059-69.
REF 38 The miRNA-17 2 cluster mediates chemoresistance and enhances tumor growth in mantle cell lymphoma via PI3K/AKT pathway activation.Leukemia. 2012 May;26(5):1064-72.
REF 39 Novel direct targets of miR-19a identified in breast cancer cells by a quantitative proteomic approach.PLoS One. 2012;7(8):e44095.
REF 40 miR 9a p targets PMEPA1 and induces prostate cancer cell proliferation, migration and invasion.Mol Med Rep. 2016 May;13(5):4030-8.
REF 41 Identification of direct targets for the miR-17-92 cluster by proteomic analysis. Proteomics. 2011 Sep;11(17):3531-9.
REF 42 MiR-19a promotes cell proliferation and invasion by targeting RhoB in human glioma cells.Neurosci Lett. 2016 Aug 15;628:161-6.
REF 43 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 44 Identification of a pan-cancer oncogenic microRNA superfamily anchored by a central core seed motif. Nat Commun. 2013;4:2730.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.