miRNA General Information
miRNA Mature ID hsa-miR-19b-1-5p
miRNA Stemloop AC MI0000074
miRNA Stemloop ID hsa-mir-19b-1
Sequence aguuuugcagguuugcauccagc
TTD Target(s) Regulated by This miRNA Fibroblast growth factor receptor 2 (FGFR2) Successful Target Target Info [1]
Vascular endothelial growth factor receptor 2 (KDR) Successful Target Target Info [1]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [1]
Caspase-8 (CASP8) Patented-recorded Target Target Info [1]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [2]
Integrin beta-8 (ITGB8) Patented-recorded Target Target Info [1]
References
REF 1 MiR-19b-1 inhibits angiogenesis by blocking cell cycle progression of endothelial cells. Biochem Biophys Res Commun. 2012 Jan 13;417(2):771-6.
REF 2 Upregulation of the miR-17-92 cluster and its two paraloga in osteosarcoma - reasons and consequences. Genes Cancer. 2014 Apr;5(1-2):56-63.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.