miRNA General Information
miRNA Mature ID hsa-miR-200b-3p
miRNA Stemloop AC MI0000342
miRNA Stemloop ID hsa-mir-200b
Sequence uaauacugccugguaaugauga
TTD Target(s) Regulated by This miRNA Vascular endothelial growth factor receptor 2 (KDR) Successful Target Target Info [1]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [2]
Programmed cell death 1 ligand 1 (PD-L1) Successful Target Target Info [3]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [1]
Vascular endothelial growth factor receptor 1 (FLT-1) Successful Target Target Info [1]
Inhibitor of nuclear factor kappa-B kinase beta (IKKB) Clinical trial Target Target Info [4]
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Clinical trial Target Target Info [5]
DNA [cytosine-5]-methyltransferase 3B (DNMT3B) Clinical trial Target Target Info [6]
Enhancer of zeste homolog 2 (EZH2) Successful Target Target Info [5]
Fibronectin (FN1) Clinical trial Target Target Info [7]
Rho-associated protein kinase 2 (ROCK2) Clinical trial Target Target Info [8]
Rotamase Pin1 (PIN1) Clinical trial Target Target Info [9]
X-linked inhibitor of apoptosis protein (XIAP) Clinical trial Target Target Info [2]
Notch-1 receptor (NOTCH1) Clinical trial Target Target Info [10]
Fascin (FSCN1) Clinical trial Target Target Info [11]
Transcription factor Sp1 (SP1) Clinical trial Target Target Info [6]
DNA [cytosine-5]-methyltransferase 3A (DNMT3A) Patented-recorded Target Target Info [6]
Extracellular signal-regulated kinase 5 (ERK5) Patented-recorded Target Target Info [12]
Transcription factor AP-1 (JUN) Discontinued Target Target Info [13]
Transforming protein RhoA (RHOA) Discontinued Target Target Info [14]
Lactate dehydrogenase A (LDHA) Literature-reported Target Target Info [15]
Cyclic AMP-responsive element-binding protein (CREB1) Literature-reported Target Target Info [16]
GATA-binding factor 4 (GATA4) Literature-reported Target Target Info [17]
Lysyl oxidase (LOX) Literature-reported Target Target Info [18]
Polycomb complex protein BMI-1 (BMI1) Literature-reported Target Target Info [19]
Protein C-ets-1 (ETS1) Literature-reported Target Target Info [20]
CDK inhibitor 1B p27Kip1 (CDKN1B) Literature-reported Target Target Info [21]
Zinc finger E-box-binding homeobox 2 (ZEB2) Literature-reported Target Target Info [22]
G1/S-specific cyclin-E2 (CCNE2) Literature-reported Target Target Info [23]
Protein(s) Regulated by This miRNA Arginine-glutamic acid dipeptide repeats protein Regulated Protein [24]
Crk-like protein Regulated Protein [25]
Disintegrin and metalloproteinase domain-containing protein 12 Regulated Protein [26]
E3 ubiquitin-protein ligase RING2 Regulated Protein [27]
Engulfment and cell motility protein 2 Regulated Protein [28]
Erbin Regulated Protein [28]
ETS translocation variant 5 Regulated Protein [29]
Fermitin family homolog 2 Regulated Protein [30]
Forkhead box protein G1 Regulated Protein [31]
Glutamyl-tRNA(Gln) amidotransferase subunit A, mitochondrial Regulated Protein [32]
Hereditary hemochromatosis protein Regulated Protein [33]
Heterogeneous nuclear ribonucleoprotein A3 Regulated Protein [33]
Homeobox protein Hox-B5 Regulated Protein [28]
Kelch-like protein 20 Regulated Protein [28]
Krueppel-like factor 11 Regulated Protein [28]
Matrin-3 Regulated Protein [34]
Moesin Regulated Protein [35]
Mothers against decapentaplegic homolog 2 Regulated Protein [36]
Oxidation resistance protein 1 Regulated Protein [37]
PH domain leucine-rich repeat-containing protein phosphatase 1 Regulated Protein [38]
Polycomb protein SUZ12 Regulated Protein [39]
Probable ATP-dependent RNA helicase DDX53 Regulated Protein [40]
Probetacellulin Regulated Protein [41]
Protein transport protein Sec23A Regulated Protein [38]
Protein VAC14 homolog Regulated Protein [28]
Proto-oncogene Wnt-1 Regulated Protein [42]
Ras and Rab interactor 2 Regulated Protein [28]
Ras association domain-containing protein 2 Regulated Protein [28]
Ras-related protein Rab-18 Regulated Protein [43]
Ras-related protein Rab-21 Regulated Protein [44]
Ras-related protein Rab-23 Regulated Protein [43]
Ras-related protein Rab-3B Regulated Protein [44]
Receptor-type tyrosine-protein phosphatase delta Regulated Protein [28]
Rho GTPase-activating protein 7 Regulated Protein [33]
Rho-related GTP-binding protein RhoE Regulated Protein [45]
Septin-7 Regulated Protein [28]
SHC-transforming protein 1 Regulated Protein [28]
Transcription factor 7-like 1 Regulated Protein [28]
Tyrosine-protein phosphatase non-receptor type 12 Regulated Protein [46]
Ubiquitin carboxyl-terminal hydrolase BAP1 Regulated Protein [28]
Ubiquitin-like protein ATG12 Regulated Protein [47]
WD repeat-containing protein 37 Regulated Protein [28]
Wiskott-Aldrich syndrome protein family member 3 Regulated Protein [48]
Zinc finger E-box-binding homeobox 1 Regulated Protein [49]
Zinc finger protein ZFPM2 Regulated Protein [28]
References
REF 1 Regulation of vascular endothelial growth factor signaling by miR-200b. Mol Cells. 2011 Jul;32(1):77-82.
REF 2 miR-200bc/429 cluster modulates multidrug resistance of human cancer cell lines by targeting BCL2 and XIAP. Cancer Chemother Pharmacol. 2012 Mar;69(3):723-31.
REF 3 Helicobacter Pylori Promote B7-H1 Expression by Suppressing miR-152 and miR-200b in Gastric Cancer Cells. PLoS One. 2017 Jan 5;12(1):e0168822.
REF 4 A negative feedback loop between miR-200b and the nuclear factor-B pathway via IKBKB/IKK- in breast cancer cells. FEBS J. 2016 Jun;283(12):2259-71.
REF 5 DNMT1 and EZH2 mediated methylation silences the microRNA-200b/a/429 gene and promotes tumor progression. Cancer Lett. 2015 Apr 10;359(2):198-205.
REF 6 miR-200b and miR-200c as prognostic factors and mediators of gastric cancer cell progression. Clin Cancer Res. 2013 Oct 15;19(20):5602-12.
REF 7 MiRNA-200b represses transforming growth factor-1-induced EMT and fibronectin expression in kidney proximal tubular cells. Am J Physiol Renal Physiol. 2013 May 15;304(10):F1266-73.
REF 8 Direct targeting of SUZ12/ROCK2 by miR-200b/c inhibits cholangiocarcinoma tumourigenesis and metastasis. Br J Cancer. 2013 Dec 10;109(12):3092-104.
REF 9 Regulation of the microRNA 200b (miRNA-200b) by transcriptional regulators PEA3 and ELK-1 protein affects expression of Pin1 protein to control anoikis. J Biol Chem. 2013 Nov 8;288(45):32742-52.
REF 10 Diallyl trisulfide inhibits proliferation, invasion and angiogenesis of osteosarcoma cells by switching on suppressor microRNAs and inactivating of Notch-1 signaling. Carcinogenesis. 2013 Jul;34(7):1601-10.
REF 11 miR-200b inhibits migration and invasion in non-small cell lung cancer cells via targeting FSCN1. Mol Med Rep. 2016 Aug;14(2):1835-40.
REF 12 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response.Genes Dev. 2011 Oct 15;25(20):2173-86.
REF 13 Identification of distinct miRNA target regulation between breast cancer molecular subtypes using AGO2-PAR-CLIP and patient datasets. Genome Biol. 2014 Jan 7;15(1):R9.
REF 14 MiRNA-200b Regulates RMP7-Induced Increases in Blood-Tumor Barrier Permeability by Targeting RhoA and ROCKII. Front Mol Neurosci. 2016 Feb 5;9:9.
REF 15 miR-200b is a key regulator of tumor progression and metabolism targeting lactate dehydrogenase A in human malignant glioma. Oncotarget. 2016 Jul 26;7(30):48423-48431.
REF 16 MicroRNA-200b targets CREB1 and suppresses cell growth in human malignant glioma. Mol Cell Biochem. 2013 Jul;379(1-2):51-8.
REF 17 miR-200b targets GATA-4 during cell growth and differentiation. RNA Biol. 2013 Apr;10(4):465-80.
REF 18 RKIP and HMGA2 regulate breast tumor survival and metastasis through lysyl oxidase and syndecan-2. Oncogene. 2014 Jul 3;33(27):3528-37.
REF 19 Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. Cancer Res. 2008 Nov 15;68(22):9125-30.
REF 20 miR-200b targets Ets-1 and is down-regulated by hypoxia to induce angiogenic response of endothelial cells. J Biol Chem. 2011 Jan 21;286(3):2047-56.
REF 21 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 22 The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol. 2008 May;10(5):593-601.
REF 23 MicroRNA-200 is commonly repressed in conjunctival MALT lymphoma, and targets cyclin E2. Graefes Arch Clin Exp Ophthalmol. 2012 Apr;250(4):523-31.
REF 24 The conserved microRNA miR-8 tunes atrophin levels to prevent neurodegeneration in Drosophila.Cell. 2007 Oct 5;131(1):136-45.
REF 25 CRKL oncogene is downregulated by p53 through miR-200s.Cancer Sci. 2015 Aug;106(8):1033-40.
REF 26 ADAM12-L is a direct target of the miR-29 and miR-200 families in breast cancer.BMC Cancer. 2015 Mar 4;15:93.
REF 27 Coordinated regulation of polycomb group complexes through microRNAs in cancer. Cancer Cell. 2011 Aug 16;20(2):187-99.
REF 28 Conserved MicroRNA miR-8/miR-200 and its target USH/FOG2 control growth by regulating PI3K.Cell. 2009 Dec 11;139(6):1096-108.
REF 29 MicroRNA-200b Impacts Breast Cancer Cell Migration and Invasion by Regulating Ezrin-Radixin-Moesin.Med Sci Monit. 2016 Jun 8;22:1946-52.
REF 30 miR-200b suppresses invasiveness and modulates the cytoskeletal and adhesive machinery in esophageal squamous cell carcinoma cells via targeting Kindlin-2.Carcinogenesis. 2014 Feb;35(2):292-301.
REF 31 MiR-200b promotes the cell proliferation and metastasis of cervical cancer by inhibiting FOXG1.Biomed Pharmacother. 2016 Apr;79:294-301.
REF 32 Downregulation of endothelial microRNA-200b supports cutaneous wound angiogenesis by desilencing GATA binding protein 2 and vascular endothelial growth factor receptor 2. Arterioscler Thromb Vasc Biol. 2012 Jun;32(6):1372-82.
REF 33 The microRNA-200 family targets multiple non-small cell lung cancer prognostic markers in H1299 cells and BEAS-2B cells.Int J Oncol. 2013 Aug;43(2):548-60.
REF 34 MicroRNA signature in massive macronodular adrenocortical disease and implications for adrenocortical tumourigenesis.Clin Endocrinol (Oxf). 2010 Jun;72(6):744-51.
REF 35 MiR-200 can repress breast cancer metastasis through ZEB1-independent but moesin-dependent pathways.Oncogene. 2014 Jul 31;33(31):4077-88.
REF 36 miR-200b inhibits TGF-1-induced epithelial-mesenchymal transition and promotes growth of intestinal epithelial cells.Cell Death Dis. 2013 Mar 14;4:e541.
REF 37 MicroRNA-200b downregulates oxidation resistance 1 (Oxr1) expression in the retina of type 1 diabetes model.Invest Ophthalmol Vis Sci. 2013 Mar 5;54(3):1689-97.
REF 38 Comparative microRNA profiling of prostate carcinomas with increasing tumor stage by deep sequencing.Mol Cancer Res. 2014 Feb;12(2):250-63.
REF 39 SUZ12 depletion suppresses the proliferation of gastric cancer cells.Cell Physiol Biochem. 2013;31(6):778-84.
REF 40 miR-200b and cancer/testis antigen CAGE form a feedback loop to regulate the invasion and tumorigenic and angiogenic responses of a cancer cell line to microtubule-targeting drugs.J Biol Chem. 2013 Dec 20;288(51):36502-18.
REF 41 ZEB1 sensitizes lung adenocarcinoma to metastasis suppression by PI3K antagonism. J Clin Invest. 2014 Jun;124(6):2696-708.
REF 42 Diallyl disulfide suppresses proliferation and induces apoptosis in human gastric cancer through Wnt-1 signaling pathway by up-regulation of miR-200b and miR-22.Cancer Lett. 2013 Oct 28;340(1):72-81.
REF 43 miR-200b as a prognostic factor targets multiple members of RAB family in glioma.Med Oncol. 2014 Mar;31(3):859.
REF 44 miR-200b as a prognostic factor in breast cancer targets multiple members of RAB family.J Transl Med. 2014 Jan 21;12:17.
REF 45 MicroRNA-200b regulates cyclin D1 expression and promotes S-phase entry by targeting RND3 in HeLa cells.Mol Cell Biochem. 2010 Nov;344(1-2):261-6.
REF 46 Involvement of human micro-RNA in growth and response to chemotherapy in human cholangiocarcinoma cell lines. Gastroenterology. 2006 Jun;130(7):2113-29.
REF 47 MiR-200b regulates autophagy associated with chemoresistance in human lung adenocarcinoma.Oncotarget. 2015 Oct 20;6(32):32805-20.
REF 48 The miR200 family of microRNAs regulates WAVE3-dependent cancer cell invasion.J Biol Chem. 2009 Nov 27;284(48):33019-29.
REF 49 The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2. J Biol Chem. 2008 May 30;283(22):14910-4.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.