miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-200b-5p | ||||
| miRNA Stemloop AC | MI0000342 | ||||
| miRNA Stemloop ID | hsa-mir-200b | ||||
| Sequence | caucuuacugggcagcauugga | ||||
| TTD Target(s) Regulated by This miRNA | Prominin-1 (PROM1) | Clinical trial Target | Target Info | [1] | |
| Transforming protein RhoA (RHOA) | Discontinued Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Ubiquitin-like protein ATG12 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | Targeting effect of microRNA on CD133 and its impact analysis on proliferation and invasion of glioma cells. Genet Mol Res. 2017 Mar 30;16(1). | ||||
| REF 2 | MiR-200b/200c/429 subfamily negatively regulates Rho/ROCK signaling pathway to suppress hepatocellular carcinoma metastasis. Oncotarget. 2015 May 30;6(15):13658-70. | ||||
| REF 3 | MiR-200b regulates autophagy associated with chemoresistance in human lung adenocarcinoma.Oncotarget. 2015 Oct 20;6(32):32805-20. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.