miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-200c-3p
miRNA Stemloop AC MI0000650
miRNA Stemloop ID hsa-mir-200c
Sequence uaauacugccggguaaugaugga
TTD Target(s) Regulated by This miRNA Vascular endothelial growth factor receptor 2 (KDR) Successful Target Target Info [1]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [2]
BDNF/NT-3 growth factors receptor (TrkB) Successful Target Target Info [3]
Endothelin A receptor (EDNRA) Successful Target Target Info [4]
Leptin receptor (LEPR) Successful Target Target Info [5]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [6]
Vascular endothelial growth factor receptor 1 (FLT-1) Successful Target Target Info [7]
Cyclin-dependent kinase 2 (CDK2) Clinical trial Target Target Info [8]
Inhibitor of nuclear factor kappa-B kinase beta (IKKB) Clinical trial Target Target Info [6]
NAD-dependent deacetylase sirtuin-1 (SIRT1) Clinical trial Target Target Info [9]
Nitric-oxide synthase endothelial (NOS3) Clinical trial Target Target Info [9]
Ribosomal protein S6 kinase beta-1 (S6K1) Clinical trial Target Target Info [10]
DNA [cytosine-5]-methyltransferase 3B (DNMT3B) Clinical trial Target Target Info [11]
Dual specificity protein phosphatase 1 (DUSP1) Clinical trial Target Target Info [12]
Fibronectin (FN1) Clinical trial Target Target Info [3]
Lysophosphatidic acid receptor 1 (LPAR1) Clinical trial Target Target Info [4]
Rho-associated protein kinase 2 (ROCK2) Successful Target Target Info [13]
Rotamase Pin1 (PIN1) Clinical trial Target Target Info [14]
Myosin light kinase (MYLK) Clinical trial Target Target Info [15]
X-linked inhibitor of apoptosis protein (XIAP) Clinical trial Target Target Info [2]
Notch-1 receptor (NOTCH1) Clinical trial Target Target Info [16]
Transcription factor Sp1 (SP1) Clinical trial Target Target Info [11]
Osteoblast cadherin (CDH11) Clinical trial Target Target Info [17]
DNA [cytosine-5]-methyltransferase 3A (DNMT3A) Patented-recorded Target Target Info [11]
NF-kappa-B-activating kinase (TBK1) Patented-recorded Target Target Info [18]
Neurotrophin-3 (NTF3) Discontinued Target Target Info [19]
Transforming protein RhoA (RHOA) Discontinued Target Target Info [4]
Protein kinase C zeta (PRKCZ) Patented-recorded Target Target Info [20]
Activin receptor type IIB (ACVR2B) Literature-reported Target Target Info [21]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [22]
Bromodomain-containing protein 7 (BRD7) Literature-reported Target Target Info [23]
Excitatory amino acid transporter 2 (SLC1A2) Literature-reported Target Target Info [24]
Forkhead box protein O1A (FOXO1) Literature-reported Target Target Info [9]
GATA-binding factor 4 (GATA4) Literature-reported Target Target Info [25]
Polycomb complex protein BMI-1 (BMI1) Clinical trial Target Target Info [26]
Protein C-ets-1 (ETS1) Literature-reported Target Target Info [7]
Homeobox protein Hox-A5 (HOXA5) Literature-reported Target Target Info [27]
Zinc finger E-box-binding homeobox 2 (ZEB2) Literature-reported Target Target Info [28]
G1/S-specific cyclin-E2 (CCNE2) Literature-reported Target Target Info [29]
Tubulin (TUB) Successful Target Target Info [30]
Protein(s) Regulated by This miRNA Cofilin-2 Regulated Protein
COF2_HUMAN
[17]
Crk-like protein Regulated Protein
CRKL_HUMAN
[32]
Disintegrin and metalloproteinase domain-containing protein 12 Regulated Protein
ADA12_HUMAN
[33]
DnaJ homolog subfamily C member 3 Regulated Protein
DNJC3_HUMAN
[10]
E3 ubiquitin-protein ligase RING2 Regulated Protein
RING2_HUMAN
[35]
Engulfment and cell motility protein 2 Regulated Protein
ELMO2_HUMAN
[36]
Ephrin-A1 Regulated Protein
EFNA1_HUMAN
[37]
ERBB receptor feedback inhibitor 1 Regulated Protein
ERRFI_HUMAN
[38]
Erbin Regulated Protein
ERBIN_HUMAN
[36]
Fibulin-5 Regulated Protein
FBLN5_HUMAN
[39]
Gem-associated protein 2 Regulated Protein
GEMI2_HUMAN
[40]
Hepatocyte nuclear factor 1-beta Regulated Protein
HNF1B_HUMAN
[41]
Hereditary hemochromatosis protein Regulated Protein
HFE_HUMAN
[42]
Homeobox protein Hox-B5 Regulated Protein
HXB5_HUMAN
[36]
Juxtaposed with another zinc finger protein 1 Regulated Protein
JAZF1_HUMAN
[10]
Kelch-like protein 20 Regulated Protein
KLH20_HUMAN
[36]
Krueppel-like factor 11 Regulated Protein
KLF11_HUMAN
[36]
Krueppel-like factor 9 Regulated Protein
KLF9_HUMAN
[6]
Metalloproteinase inhibitor 2 Regulated Protein
TIMP2_HUMAN
[39]
Moesin Regulated Protein
MOES_HUMAN
[3]
Neural cell adhesion molecule 1 Regulated Protein
NCAM1_HUMAN
[45]
Noggin Regulated Protein
NOGG_HUMAN
[27]
Phorbol-12-myristate-13-acetate-induced protein 1 Regulated Protein
APR_HUMAN
[47]
Polycomb protein SUZ12 Regulated Protein
SUZ12_HUMAN
[13]
Polycystin-1 Regulated Protein
PKD1_HUMAN
[27]
Probetacellulin Regulated Protein
BTC_HUMAN
[49]
Programmed cell death protein 10 Regulated Protein
PDC10_HUMAN
[41]
Protein jagged-1 Regulated Protein
JAG1_HUMAN
[50]
Protein jagged-1 Regulated Protein
JAG1_HUMAN
[51]
Protein odd-skipped-related 1 Regulated Protein
OSR1_HUMAN
[27]
Protein transport protein Sec23A Regulated Protein
SC23A_HUMAN
[17]
Protein VAC14 homolog Regulated Protein
VAC14_HUMAN
[36]
Ras and Rab interactor 2 Regulated Protein
RIN2_HUMAN
[36]
Ras association domain-containing protein 2 Regulated Protein
RASF2_HUMAN
[36]
Receptor-type tyrosine-protein phosphatase delta Regulated Protein
PTPRD_HUMAN
[36]
REST corepressor 3 Regulated Protein
RCOR3_HUMAN
[52]
Rho GTPase-activating protein 7 Regulated Protein
RHG07_HUMAN
[42]
Rho-related GTP-binding protein RhoE Regulated Protein
RND3_HUMAN
[53]
Septin-7 Regulated Protein
SEPT7_HUMAN
[36]
SH3 and PX domain-containing protein 2A Regulated Protein
SPD2A_HUMAN
[15]
SHC-transforming protein 1 Regulated Protein
SHC1_HUMAN
[36]
SUMO-conjugating enzyme UBC9 Regulated Protein
UBC9_HUMAN
[55]
Transcription factor 7-like 1 Regulated Protein
TF7L1_HUMAN
[36]
Transcriptional activator GLI3 Regulated Protein
GLI3_HUMAN
[27]
Transcriptional regulator ATRX Regulated Protein
ATRX_HUMAN
[42]
Ubiquilin-1 Regulated Protein
UBQL1_HUMAN
[56]
Ubiquitin carboxyl-terminal hydrolase 25 Regulated Protein
UBP25_HUMAN
[57]
Ubiquitin carboxyl-terminal hydrolase BAP1 Regulated Protein
BAP1_HUMAN
[36]
WD repeat-containing protein 37 Regulated Protein
WDR37_HUMAN
[36]
Zinc finger E-box-binding homeobox 1 Regulated Protein
ZEB1_HUMAN
[58]
Zinc finger protein ZFPM1 Regulated Protein
FOG1_HUMAN
[49]
Zinc finger protein ZFPM2 Regulated Protein
FOG2_HUMAN
[36]
Zinc finger transcription factor Trps1 Regulated Protein
TRPS1_HUMAN
[27]
References
REF 1 MiR-200c increases the radiosensitivity of non-small-cell lung cancer cell line A549 by targeting VEGF-VEGFR2 pathway. PLoS One. 2013 Oct 30;8(10):e78344.
REF 2 miR-200bc/429 cluster modulates multidrug resistance of human cancer cell lines by targeting BCL2 and XIAP. Cancer Chemother Pharmacol. 2012 Mar;69(3):723-31.
REF 3 Targets of miR-200c mediate suppression of cell motility and anoikis resistance. Breast Cancer Res. 2011 Apr 18;13(2):R45.
REF 4 Regulation of trabecular meshwork cell contraction and intraocular pressure by miR-200c. PLoS One. 2012;7(12):e51688.
REF 5 Leptin-STAT3-G9a Signaling Promotes Obesity-Mediated Breast Cancer Progression. Cancer Res. 2015 Jun 1;75(11):2375-2386.
REF 6 Endometrial miR-200c is altered during transformation into cancerous states and targets the expression of ZEBs, VEGFA, FLT1, IKK, KLF9, and FBLN5. Reprod Sci. 2012 Aug;19(8):786-96.
REF 7 MicroRNA-200c modulates epithelial-to-mesenchymal transition (EMT) in human colorectal cancer metastasis. Gut. 2013 Sep;62(9):1315-26.
REF 8 miR-200c Targets CDK2 and Suppresses Tumorigenesis in Renal Cell Carcinoma. Mol Cancer Res. 2015 Dec;13(12):1567-77.
REF 9 Blood hsa-miR-122-5p and hsa-miR-885-5p levels associate with fatty liver and related lipoprotein metabolism-The Young Finns Study. Sci Rep. 2016 Dec 5;6:38262.
REF 10 The microRNA-200 family regulates pancreatic beta cell survival in type 2 diabetes. Nat Med. 2015 Jun;21(6):619-27.
REF 11 miR-200b and miR-200c as prognostic factors and mediators of gastric cancer cell progression. Clin Cancer Res. 2013 Oct 15;19(20):5602-12.
REF 12 Dysregulation of miR-106a and miR-591 confers paclitaxel resistance to ovarian cancer. Br J Cancer. 2013 Jul 23;109(2):452-61.
REF 13 Direct targeting of SUZ12/ROCK2 by miR-200b/c inhibits cholangiocarcinoma tumourigenesis and metastasis. Br J Cancer. 2013 Dec 10;109(12):3092-104.
REF 14 Prolyl isomerase Pin1 acts downstream of miR200c to promote cancer stem-like cell traits in breast cancer. Cancer Res. 2014 Jul 1;74(13):3603-16.
REF 15 The ZEB1/miR-200c feedback loop regulates invasion via actin interacting proteins MYLK and TKS5. Oncotarget. 2015 Sep 29;6(29):27083-96.
REF 16 Integrative genetic, epigenetic and pathological analysis of paraganglioma reveals complex dysregulation of NOTCH signaling. Acta Neuropathol. 2013 Oct;126(4):575-94.
REF 17 A systematic evaluation of miRNA:mRNA interactions involved in the migration and invasion of breast cancer cells. J Transl Med. 2013 Mar 5;11:57.
REF 18 miR-200c enhances radiosensitivity of human breast cancer cells. J Cell Biochem. 2013 Mar;114(3):606-15.
REF 19 miR-200c targets a NF-B up-regulated TrkB/NTF3 autocrine signaling loop to enhance anoikis sensitivity in triple negative breast cancer. PLoS One. 2012;7(11):e49987.
REF 20 Retinoic acid directs breast cancer cell state changes through regulation of TET2-PKC pathway. Oncogene. 2017 Jun 1;36(22):3193-3206.
REF 21 miR-192, miR-194, miR-215, miR-200c and miR-141 are downregulated and their common target ACVR2B is strongly expressed in renal childhood neoplasms. Carcinogenesis. 2012 May;33(5):1014-21.
REF 22 The Protective Role of microRNA-200c in Alzheimer's Disease Pathologies Is Induced by Beta Amyloid-Triggered Endoplasmic Reticulum Stress. Front Mol Neurosci. 2016 Dec 8;9:140.
REF 23 The interactions between MicroRNA-200c and BRD7 in endometrial carcinoma. Gynecol Oncol. 2012 Jan;124(1):125-33.
REF 24 Identification of miR-31-5p, miR-141-3p, miR-200c-3p, and GLT1 as human liver aging markers sensitive to donor-recipient age-mismatch in transplants. Aging Cell. 2017 Apr;16(2):262-272.
REF 25 miR-200c and GATA binding protein 4 regulate human embryonic stem cell renewal and differentiation. Stem Cell Res. 2014 Mar;12(2):338-53.
REF 26 Downregulation of miRNA-200c links breast cancer stem cells with normal stem cells. Cell. 2009 Aug 7;138(3):592-603.
REF 27 MicroRNA expression profiling and target genes study in congenital microtia. Int J Pediatr Otorhinolaryngol. 2013 Apr;77(4):483-7.
REF 28 The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol. 2008 May;10(5):593-601.
REF 29 MicroRNA-200 is commonly repressed in conjunctival MALT lymphoma, and targets cyclin E2. Graefes Arch Clin Exp Ophthalmol. 2012 Apr;250(4):523-31.
REF 30 MicroRNA-200c mitigates invasiveness and restores sensitivity to microtubule-targeting chemotherapeutic agents. Mol Cancer Ther. 2009 May;8(5):1055-66.
REF 31 A systematic evaluation of miRNA:mRNA interactions involved in the migration and invasion of breast cancer cells. J Transl Med. 2013 Mar 5;11:57.
REF 32 CRKL oncogene is downregulated by p53 through miR-200s.Cancer Sci. 2015 Aug;106(8):1033-40.
REF 33 ADAM12-L is a direct target of the miR-29 and miR-200 families in breast cancer.BMC Cancer. 2015 Mar 4;15:93.
REF 34 The microRNA-200 family regulates pancreatic beta cell survival in type 2 diabetes. Nat Med. 2015 Jun;21(6):619-27.
REF 35 Coordinated regulation of polycomb group complexes through microRNAs in cancer. Cancer Cell. 2011 Aug 16;20(2):187-99.
REF 36 Conserved MicroRNA miR-8/miR-200 and its target USH/FOG2 control growth by regulating PI3K.Cell. 2009 Dec 11;139(6):1096-108.
REF 37 G-A variant in miR-200c binding site of EFNA1 alters susceptibility to gastric cancer.Mol Carcinog. 2014 Mar;53(3):219-29.
REF 38 miR-200 expression regulates epithelial-to-mesenchymal transition in bladder cancer cells and reverses resistance to epidermal growth factor receptor therapy.Clin Cancer Res. 2009 Aug 15;15(16):5060-72.
REF 39 miR-200c is aberrantly expressed in leiomyomas in an ethnic-dependent manner and targets ZEBs, VEGFA, TIMP2, and FBLN5. Endocr Relat Cancer. 2012 Jul 22;19(4):541-56.
REF 40 The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev. 2008 Apr 1;22(7):894-907.
REF 41 Essential role of miR-200c in regulating self-renewal of breast cancer stem cells and their counterparts of mammary epithelium.BMC Cancer. 2015 Sep 23;15:645.
REF 42 The microRNA-200 family targets multiple non-small cell lung cancer prognostic markers in H1299 cells and BEAS-2B cells.Int J Oncol. 2013 Aug;43(2):548-60.
REF 43 Endometrial miR-200c is altered during transformation into cancerous states and targets the expression of ZEBs, VEGFA, FLT1, IKK, KLF9, and FBLN5. Reprod Sci. 2012 Aug;19(8):786-96.
REF 44 Targets of miR-200c mediate suppression of cell motility and anoikis resistance. Breast Cancer Res. 2011 Apr 18;13(2):R45.
REF 45 Transcriptomic profiling reveals hepatic stem-like gene signatures and interplay of miR-200c and epithelial-mesenchymal transition in intrahepatic cholangiocarcinoma.Hepatology. 2012 Nov;56(5):1792-803.
REF 46 MicroRNA expression profiling and target genes study in congenital microtia. Int J Pediatr Otorhinolaryngol. 2013 Apr;77(4):483-7.
REF 47 MiR-200c regulates Noxa expression and sensitivity to proteasomal inhibitors.PLoS One. 2012;7(5):e36490.
REF 48 Direct targeting of SUZ12/ROCK2 by miR-200b/c inhibits cholangiocarcinoma tumourigenesis and metastasis. Br J Cancer. 2013 Dec 10;109(12):3092-104.
REF 49 ZEB1 sensitizes lung adenocarcinoma to metastasis suppression by PI3K antagonism. J Clin Invest. 2014 Jun;124(6):2696-708.
REF 50 The ZEB1/miR-200 feedback loop controls Notch signalling in cancer cells.EMBO J. 2011 Feb 16;30(4):770-82.
REF 51 Notch1 Pathway Activation Results from the Epigenetic Abrogation of Notch-Related MicroRNAs in Mycosis Fungoides.J Invest Dermatol. 2015 Dec;135(12):3144-3152.
REF 52 MicroRNAs coordinately regulate protein complexes.BMC Syst Biol. 2011 Aug 25;5:136.
REF 53 MicroRNA-200c regulates the sensitivity of chemotherapy of gastric cancer SGC7901/DDP cells by directly targeting RhoE.Pathol Oncol Res. 2014 Jan;20(1):93-8.
REF 54 The ZEB1/miR-200c feedback loop regulates invasion via actin interacting proteins MYLK and TKS5. Oncotarget. 2015 Sep 29;6(29):27083-96.
REF 55 MicroRNA-mediated regulation of Ubc9 expression in cancer cells.Clin Cancer Res. 2009 Mar 1;15(5):1550-7.
REF 56 MiR-200c inhibits autophagy and enhances radiosensitivity in breast cancer cells by targeting UBQLN1.Int J Cancer. 2015 Mar 1;136(5):1003-12.
REF 57 miRNA-200c inhibits invasion and metastasis of human non-small cell lung cancer by directly targeting ubiquitin specific peptidase 25.Mol Cancer. 2014 Jul 6;13:166.
REF 58 A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. EMBO Rep. 2008 Jun;9(6):582-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.