miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-202-3p | ||||
| miRNA Stemloop AC | MI0003130 | ||||
| miRNA Stemloop ID | hsa-mir-202 | ||||
| Sequence | agagguauagggcaugggaa | ||||
| TTD Target(s) Regulated by This miRNA | Matrix metalloproteinase-1 (MMP-1) | Successful Target | Target Info | [1] | |
| B-cell-activating factor (TNFSF13B) | Successful Target | Target Info | [2] | ||
| Zinc finger protein GLI1 (Gli1) | Patented-recorded Target | Target Info | [3] | ||
| LDL receptor related protein-6 (LRP-6) | Clinical trial Target | Target Info | [4] | ||
| N-myc proto-oncogene protein (MYCN) | Literature-reported Target | Target Info | [5] | ||
| Protein(s) Regulated by This miRNA | ADP-ribosylation factor-like protein 5A | Regulated Protein | [6] | ||
| Hyaluronan synthase 2 | Regulated Protein | [7] | |||
| Programmed cell death protein 4 | Regulated Protein | [8] | |||
| Transcription factor SOX-6 | Regulated Protein | [9] | |||
| References | |||||
| REF 1 | MicroRNA-202-3p regulates scleroderma fibrosis by targeting matrix metalloproteinase 1. Biomed Pharmacother. 2017 Mar;87:412-418. | ||||
| REF 2 | Study on the Association Between miRNA-202 Expression and Drug Sensitivity in Multiple Myeloma Cells. Pathol Oncol Res. 2016 Jul;22(3):531-9. | ||||
| REF 3 | Decrease of miR-202-3p expression, a novel tumor suppressor, in gastric cancer. PLoS One. 2013 Jul 25;8(7):e69756. | ||||
| REF 4 | miR-202 suppresses cell proliferation in human hepatocellular carcinoma by downregulating LRP6 post-transcriptionally. FEBS Lett. 2014 May 21;588(10):1913-20. | ||||
| REF 5 | Tumour-suppressor microRNAs let-7 and mir-101 target the proto-oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastoma. Br J Cancer. 2011 Jul 12;105(2):296-303. | ||||
| REF 6 | microRNA-202-3p inhibits cell proliferation by targeting ADP-ribosylation factor-like 5A in human colorectal carcinoma.Clin Cancer Res. 2014 Mar 1;20(5):1146-57. | ||||
| REF 7 | Targetome profiling, pathway analysis and genetic association study implicate miR-202 in lymphomagenesis.Cancer Epidemiol Biomarkers Prev. 2013 Mar;22(3):327-36. | ||||
| REF 8 | TGF-1-induced miR-202 mediates drug resistance by inhibiting apoptosis in human osteosarcoma.J Cancer Res Clin Oncol. 2016 Jan;142(1):239-46. | ||||
| REF 9 | MiR-202 promotes endometriosis by regulating SOX6 expression. Int J Clin Exp Med. 2015 Oct 15;8(10):17757-64. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.