miRNA General Information
miRNA Mature ID	hsa-miR-202-5p
miRNA Stemloop AC	MI0003130
miRNA Stemloop ID	hsa-mir-202
Sequence	uuccuaugcauauacuucuuug
TTD Target(s) Regulated by This miRNA	B-cell-activating factor (TNFSF13B)	Successful Target	Target Info	[1]
	TGF-beta receptor type I (TGFBR1)	Clinical trial Target	Target Info	[2]
	TGF-beta receptor type II (TGFBR2)	Clinical trial Target	Target Info	[2]
References
REF 1	miRNA-202 in bone marrow stromal cells affects the growth and adhesion of multiple myeloma cells by regulating B cell-activating factor. Clin Exp Med. 2016 Aug;16(3):307-16.
REF 2	miR-202 Diminishes TGF Receptors and Attenuates TGF1-Induced EMT in Pancreatic Cancer. Mol Cancer Res. 2017 Aug;15(8):1029-1039.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.