miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-204-5p | ||||
| miRNA Stemloop AC | MI0000284 | ||||
| miRNA Stemloop ID | hsa-mir-204 | ||||
| Sequence | uucccuuugucauccuaugccu | ||||
| TTD Target(s) Regulated by This miRNA | Janus kinase 2 (JAK-2) | Successful Target | Target Info | [1] | |
| Alkaline phosphatase tissue-nonspecific (ALPL) | Successful Target | Target Info | [2] | ||
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [3] | ||
| BDNF/NT-3 growth factors receptor (TrkB) | Successful Target | Target Info | [4] | ||
| C-X-C chemokine receptor type 4 (CXCR4) | Successful Target | Target Info | [5] | ||
| Interleukin-8 (IL8) | Successful Target | Target Info | [6] | ||
| Prostaglandin G/H synthase 2 (COX-2) | Successful Target | Target Info | [7] | ||
| Thyroid hormone receptor beta (THRB) | Successful Target | Target Info | [8] | ||
| Mannose-6-phosphate receptor (M6PR) | Successful Target | Target Info | [6] | ||
| ERK activator kinase 1 (MEK1) | Clinical trial Target | Target Info | [9] | ||
| Matrix metalloproteinase-9 (MMP-9) | Clinical trial Target | Target Info | [10] | ||
| Aurora kinase B (AURKB) | Clinical trial Target | Target Info | [11] | ||
| NAD-dependent deacetylase sirtuin-1 (SIRT1) | Clinical trial Target | Target Info | [12] | ||
| TGF-beta receptor type I (TGFBR1) | Clinical trial Target | Target Info | [13] | ||
| Apoptosis regulator Bcl-W (BCL-W) | Clinical trial Target | Target Info | [6] | ||
| Dipeptidyl peptidase I (CTSC) | Clinical trial Target | Target Info | [14] | ||
| M-phase inducer phosphatase 2 (MPIP2) | Clinical trial Target | Target Info | [14] | ||
| Cellular inhibitor of apoptosis 1 (BIRC2) | Clinical trial Target | Target Info | [6] | ||
| Interleukin-11 (IL11) | Clinical trial Target | Target Info | [6] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [13] | ||
| Brain-derived neurotrophic factor (BDNF) | Clinical trial Target | Target Info | [15] | ||
| Sclerostin (SOST) | Successful Target | Target Info | [2] | ||
| Osteoblast cadherin (CDH11) | Clinical trial Target | Target Info | [14] | ||
| Matrix metalloproteinase-3 (MMP-3) | Patented-recorded Target | Target Info | [14] | ||
| Bone morphogenetic protein 1 (BMP1) | Literature-reported Target | Target Info | [14] | ||
| NADPH oxidase 2 (CYBB) | Literature-reported Target | Target Info | [16] | ||
| Cyclic AMP-responsive element-binding protein (CREB1) | Literature-reported Target | Target Info | [17] | ||
| Forkhead box protein M1 (FOXM1) | Literature-reported Target | Target Info | [18] | ||
| Insulin-like growth factor-binding protein 2 (IGFBP2) | Literature-reported Target | Target Info | [19] | ||
| Prostate derived ETS factor (SPDEF) | Literature-reported Target | Target Info | [20] | ||
| Vitamin D3 up-regulated protein 1 (VDUP1) | Literature-reported Target | Target Info | [21] | ||
| Epithelial cadherin (CDH1) | Literature-reported Target | Target Info | [22] | ||
| ETS-domain transcription factor ERF (ERF) | Literature-reported Target | Target Info | [14] | ||
| Integrin alpha-4/beta-4 (ITGA4/B4) | Literature-reported Target | Target Info | [14] | ||
| IP3 receptor isoform 1 (ITPR1) | Literature-reported Target | Target Info | [9] | ||
| Long transient receptor potential channel 3 (TRPM3) | Literature-reported Target | Target Info | [23] | ||
| Osteonectin (SPARC) | Literature-reported Target | Target Info | [24] | ||
| Ras-related protein Rab-22A (Rab22a) | Literature-reported Target | Target Info | [6] | ||
| Forkhead box protein C1 (FOXC1) | Literature-reported Target | Target Info | [25] | ||
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [26] | ||
| Runt-related transcription factor 2 (RUNX2) | Literature-reported Target | Target Info | [27] | ||
| Protein(s) Regulated by This miRNA | #VALUE! | Regulated Protein | [17] | ||
| Ankyrin repeat domain-containing protein 13A | Regulated Protein | [29] | |||
| AP-1 complex subunit sigma-2 | Regulated Protein | [6] | |||
| Cell division control protein 42 homolog | Regulated Protein | [31] | |||
| Cyclic AMP-responsive element-binding protein 5 | Regulated Protein | [32] | |||
| Elongation of very long chain fatty acids protein 6 | Regulated Protein | [32] | |||
| Ephrin-B2 | Regulated Protein | [33] | |||
| ER degradation-enhancing alpha-mannosidase-like protein 1 | Regulated Protein | [6] | |||
| Ezrin | Regulated Protein | [6] | |||
| Ezrin | Regulated Protein | [34] | |||
| Frizzled-1 | Regulated Protein | [6] | |||
| Homeobox protein CDX-2 | Regulated Protein | [35] | |||
| Homeobox protein HMX1 | Regulated Protein | [36] | |||
| Homeobox protein Hox-A10 | Regulated Protein | [37] | |||
| Homeobox protein Meis1 | Regulated Protein | [37] | |||
| Homeobox protein Meis2 | Regulated Protein | [38] | |||
| Homeobox protein SIX1 | Regulated Protein | [39] | |||
| Interferon-induced GTP-binding protein Mx1 | Regulated Protein | [21] | |||
| Microtubule-associated proteins 1A/1B light chain 3B | Regulated Protein | [41] | |||
| Mothers against decapentaplegic homolog 4 | Regulated Protein | [42] | |||
| Ras-related protein Rab-40B | Regulated Protein | [6] | |||
| Segment polarity protein dishevelled homolog DVL-3 | Regulated Protein | [43] | |||
| Serine incorporator 3 | Regulated Protein | [6] | |||
| Stress-associated endoplasmic reticulum protein 1 | Regulated Protein | [6] | |||
| Transcription factor 12 | Regulated Protein | [6] | |||
| Transcription factor 4 | Regulated Protein | [6] | |||
| Transcription factor SOX-4 | Regulated Protein | [33] | |||
| Transmembrane protease serine 3 | Regulated Protein | [44] | |||
| Ubiquitin carboxyl-terminal hydrolase 47 | Regulated Protein | [45] | |||
| Vimentin | Regulated Protein | [22] | |||
| Zinc finger protein SNAI1 | Regulated Protein | [13] | |||
| Zinc finger protein SNAI2 | Regulated Protein | [13] | |||
| References | |||||
| REF 1 | miR-204 suppresses non-small-cell lung carcinoma (NSCLC) invasion and migration by targeting JAK2. Genet Mol Res. 2016 May 20;15(2). | ||||
| REF 2 | Identification and characterization of microRNAs controlled by the osteoblast-specific transcription factor Osterix. PLoS One. 2013;8(3):e58104. | ||||
| REF 3 | MicroRNA microarray identifies Let-7i as a novel biomarker and therapeutic target in human epithelial ovarian cancer. Cancer Res. 2008 Dec 15;68(24):10307-14. | ||||
| REF 4 | MicroRNA-204 increases sensitivity of neuroblastoma cells to cisplatin and is associated with a favourable clinical outcome. Br J Cancer. 2012 Sep 4;107(6):967-76. | ||||
| REF 5 | miR-204-5p regulates cell proliferation and metastasis through inhibiting CXCR4 expression in OSCC. Biomed Pharmacother. 2016 Aug;82:202-7. | ||||
| REF 6 | Role of miR-204 in the regulation of apoptosis, endoplasmic reticulum stress response, and inflammation in human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2011 May 6;52(6):2999-3007. | ||||
| REF 7 | Pulmonary microRNA expression profiling in an immature piglet model of cardiopulmonary bypass-induced acute lung injury. Artif Organs. 2015 Apr;39(4):327-35. | ||||
| REF 8 | Untranslated regions of thyroid hormone receptor beta 1 mRNA are impaired in human clear cell renal cell carcinoma. Biochim Biophys Acta. 2010 Nov;1802(11):995-1005. | ||||
| REF 9 | The changes of miRNA expression in rat hippocampus following chronic lead exposure. Toxicol Lett. 2014 Aug 17;229(1):158-66. | ||||
| REF 10 | MicroRNA-21 modulates biological functions of pancreatic cancer cells including their proliferation, invasion, and chemoresistance. Mol Cancer Ther. 2009 May;8(5):1067-74. | ||||
| REF 11 | miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to "seedless" 3'UTR microRNA recognition elements. Mol Cell. 2009 Sep 11;35(5):610-25. | ||||
| REF 12 | MiR-204 down regulates SIRT1 and reverts SIRT1-induced epithelial-mesenchymal transition, anoikis resistance and invasion in gastric cancer cells. BMC Cancer. 2013 Jun 14;13:290. | ||||
| REF 13 | MicroRNA-204/211 alters epithelial physiology. FASEB J. 2010 May;24(5):1552-71. | ||||
| REF 14 | Network modeling identifies molecular functions targeted by miR-204 to suppress head and neck tumor metastasis. PLoS Comput Biol. 2010 Apr 1;6(4):e1000730. | ||||
| REF 15 | Genomic loss of tumor suppressor miRNA-204 promotes cancer cell migration and invasion by activating AKT/mTOR/Rac1 signaling and actin reorganization. PLoS One. 2012;7(12):e52397. | ||||
| REF 16 | High-throughput screening identifies microRNAs that target Nox2 and improve function after acute myocardial infarction. Am J Physiol Heart Circ Physiol. 2017 May 1;312(5):H1002-H1012. | ||||
| REF 17 | LncRNA-UCA1 enhances cell proliferation and 5-fluorouracil resistance in colorectal cancer by inhibiting miR-204-5p. Sci Rep. 2016 Apr 5;6:23892. | ||||
| REF 18 | miR-204 inhibits invasion and epithelial-mesenchymal transition by targeting FOXM1 in esophageal cancer. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12775-83. | ||||
| REF 19 | The miR-204-3p-targeted IGFBP2 pathway is involved in xanthohumol-induced glioma cell apoptotic death. Neuropharmacology. 2016 Nov;110(Pt A):362-375. | ||||
| REF 20 | MicroRNA-mediated inhibition of prostate-derived Ets factor messenger RNA translation affects prostate-derived Ets factor regulatory networks in human breast cancer. Cancer Res. 2008 Oct 15;68(20):8499-506. | ||||
| REF 21 | Genome-wide identification of target genes for miR-204 and miR-211 identifies their proliferation stimulatory role in breast cancer cells. Sci Rep. 2016 Apr 28;6:25287. | ||||
| REF 22 | miR-204 inhibits epithelial to mesenchymal transition by targeting slug in intrahepatic cholangiocarcinoma cells. Cell Physiol Biochem. 2013;32(5):1331-41. | ||||
| REF 23 | TRPM3 and miR-204 establish a regulatory circuit that controls oncogenic autophagy in clear cell renal cell carcinoma. Cancer Cell. 2014 Nov 10;26(5):738-53. | ||||
| REF 24 | MicroRNA 29c is down-regulated in nasopharyngeal carcinomas, up-regulating mRNAs encoding extracellular matrix proteins. Proc Natl Acad Sci U S A. 2008 Apr 15;105(15):5874-8. | ||||
| REF 25 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 26 | High mobility group A2 is a target for miRNA-98 in head and neck squamous cell carcinoma. Mol Cancer. 2007 Jan 14;6:5. | ||||
| REF 27 | MicroRNA-204 regulates vascular smooth muscle cell calcification in vitro and in vivo. Cardiovasc Res. 2012 Nov 1;96(2):320-9. | ||||
| REF 28 | LncRNA-UCA1 enhances cell proliferation and 5-fluorouracil resistance in colorectal cancer by inhibiting miR-204-5p. Sci Rep. 2016 Apr 5;6:23892. | ||||
| REF 29 | miR-204 targeting of Ankrd13A controls both mesenchymal neural crest and lens cell migration.PLoS One. 2013 Apr 19;8(4):e61099. | ||||
| REF 30 | Role of miR-204 in the regulation of apoptosis, endoplasmic reticulum stress response, and inflammation in human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2011 May 6;52(6):2999-3007. | ||||
| REF 31 | Down-regulation of miRNA-204 by LMP-1 enhances CDC42 activity and facilitates invasion of EBV-associated nasopharyngeal carcinoma cells.FEBS Lett. 2014 May 2;588(9):1562-70. | ||||
| REF 32 | Microphthalmia-associated transcription factor (MITF) promotes differentiation of human retinal pigment epithelium (RPE) by regulating microRNAs-204/211 expression. J Biol Chem. 2012 Jun 8;287(24):20491-503. | ||||
| REF 33 | Loss of miR-204 expression enhances glioma migration and stem cell-like phenotype.Cancer Res. 2013 Jan 15;73(2):990-9. | ||||
| REF 34 | A microRNA contribution to aberrant Ras activation in gastric cancer. Am J Transl Res. 2011 Feb;3(2):209-18. | ||||
| REF 35 | MiR-9 downregulates CDX2 expression in gastric cancer cells.Int J Cancer. 2011 Dec 1;129(11):2611-20. | ||||
| REF 36 | MiR-204/miR-211 downregulation contributes to candidemia-induced kidney injuries via derepression of Hmx1 expression.Life Sci. 2014 May 2;102(2):139-44. | ||||
| REF 37 | Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. Proc Natl Acad Sci U S A. 2008 Mar 11;105(10):3945-50. | ||||
| REF 38 | miR-204 is required for lens and retinal development via Meis2 targeting.Proc Natl Acad Sci U S A. 2010 Aug 31;107(35):15491-6. | ||||
| REF 39 | miR-204 functions as a tumor suppressor by regulating SIX1 in NSCLC.FEBS Lett. 2014 Oct 16;588(20):3703-12. | ||||
| REF 40 | Genome-wide identification of target genes for miR-204 and miR-211 identifies their proliferation stimulatory role in breast cancer cells. Sci Rep. 2016 Apr 28;6:25287. | ||||
| REF 41 | VHL-regulated MiR-204 suppresses tumor growth through inhibition of LC3B-mediated autophagy in renal clear cell carcinoma.Cancer Cell. 2012 Apr 17;21(4):532-46. | ||||
| REF 42 | MicroRNA-204-5p regulates epithelial-to-mesenchymal transition during human posterior capsule opacification by targeting SMAD4.Invest Ophthalmol Vis Sci. 2013 Jan 14;54(1):323-32. | ||||
| REF 43 | miR-204-5p promotes the adipogenic differentiation of human adipose-derived mesenchymal stem cells by modulating DVL3 expression and suppressing Wnt/-catenin signaling.Int J Mol Med. 2015 Jun;35(6):1587-95. | ||||
| REF 44 | miR-204 suppresses cochlear spiral ganglion neuron survival initro by targeting TMPRSS3.Hear Res. 2014 Aug;314:60-4. | ||||
| REF 45 | MicroRNA-204-5p inhibits gastric cancer cell proliferation by downregulating USP47 and RAB22A. Med Oncol. 2015 Jan;32(1):331. | ||||
| REF 46 | miR-204 inhibits epithelial to mesenchymal transition by targeting slug in intrahepatic cholangiocarcinoma cells. Cell Physiol Biochem. 2013;32(5):1331-41. | ||||
| REF 47 | MicroRNA-204/211 alters epithelial physiology. FASEB J. 2010 May;24(5):1552-71. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.