miRNA General Information
miRNA Mature ID hsa-miR-205-5p
miRNA Stemloop AC MI0000285
miRNA Stemloop ID hsa-mir-205
Sequence uccuucauuccaccggagucug
TTD Target(s) Regulated by This miRNA Erbb2 tyrosine kinase receptor (HER2) Successful Target Target Info [1]
Proto-oncogene c-Src (SRC) Successful Target Target Info [2]
Androgen receptor (AR) Successful Target Target Info [3]
Opioid receptor sigma 1 (OPRS1) Successful Target Target Info [4]
Protein kinase C epsilon (PRKCE) Successful Target Target Info [5]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [6]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [7]
Inward rectifier potassium channel Kir1.2 (KCNJ10) Successful Target Target Info [8]
Yes tyrosine kinase (YES) Clinical trial Target Target Info [2]
Erbb3 tyrosine kinase receptor (Erbb-3) Clinical trial Target Target Info [9]
HIF-prolyl hydroxylase 1 (HPH-1) Clinical trial Target Target Info [10]
Integrin alpha-5 (ITGA5) Clinical trial Target Target Info [11]
Connective tissue growth factor (CTGF) Clinical trial Target Target Info [12]
Interleukin-24 (IL24) Clinical trial Target Target Info [13]
Leucine-rich repeat kinase 2 (LRRK2) Clinical trial Target Target Info [14]
ATP-dependent RNA helicase DDX5 (DDX5) Clinical trial Target Target Info [4]
E2F transcription factor 1 (E2F1) Clinical trial Target Target Info [15]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [16]
Estrogen-related receptor-gamma (ESRRG) Literature-reported Target Target Info [17]
High mobility group protein B1 (HMGB1) Literature-reported Target Target Info [18]
LDL receptor related protein-1 (LRP-1) Literature-reported Target Target Info [19]
Cysteine-rich angiogenic inducer 61 (CYR61) Literature-reported Target Target Info [12]
Zinc finger E-box-binding homeobox 2 (ZEB2) Literature-reported Target Target Info [20]
Runt-related transcription factor 2 (RUNX2) Literature-reported Target Target Info [21]
Protein(s) Regulated by This miRNA B-cell lymphoma 6 protein Regulated Protein [22]
Centromere protein F Regulated Protein [23]
Cyclin-J Regulated Protein [24]
DNA-binding protein SATB2 Regulated Protein [25]
Ezrin Regulated Protein [26]
High mobility group protein B3 Regulated Protein [27]
Interleukin-32 Regulated Protein [13]
Laminin subunit gamma-1 Regulated Protein [29]
Long-chain-fatty-acid--CoA ligase 1 Regulated Protein [30]
Long-chain-fatty-acid--CoA ligase 4 Regulated Protein [31]
Mediator of RNA polymerase II transcription subunit 1 Regulated Protein [4]
Mothers against decapentaplegic homolog 2 Regulated Protein [33]
Mothers against decapentaplegic homolog 4 Regulated Protein [34]
Peroxiredoxin-2 Regulated Protein [35]
PH domain leucine-rich repeat-containing protein phosphatase 2 Regulated Protein [36]
Phosphatidylinositol 3,4,5-trisphosphate 5-phosphatase 2 Regulated Protein [37]
Prelamin-A/C Regulated Protein [26]
Receptor-type tyrosine-protein phosphatase mu Regulated Protein [38]
Transcription factor E2F5 Regulated Protein [15]
Transcriptional repressor protein YY1 Regulated Protein [40]
Tumor protein p73 Regulated Protein [41]
UV radiation resistance-associated gene protein Regulated Protein [42]
Zinc finger E-box-binding homeobox 1 Regulated Protein [20]
References
REF 1 ErbB2 down-regulates microRNA-205 in breast cancer. Biochem Biophys Res Commun. 2011 Aug 12;411(4):804-8.
REF 2 MicroRNA-205 inhibits Src-mediated oncogenic pathways in renal cancer. Cancer Res. 2011 Apr 1;71(7):2611-21.
REF 3 miR-205 negatively regulates the androgen receptor and is associated with adverse outcome of prostate cancer patients. Br J Cancer. 2013 Apr 30;108(8):1668-76.
REF 4 MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9.
REF 5 miR-205 Exerts tumor-suppressive functions in human prostate through down-regulation of protein kinase Cepsilon. Cancer Res. 2009 Mar 15;69(6):2287-95.
REF 6 MicroRNA-205, a novel regulator of the anti-apoptotic protein Bcl2, is downregulated in prostate cancer. Int J Oncol. 2013 Jul;43(1):307-14.
REF 7 The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 8 Inhibition of miR-205 impairs the wound-healing process in human corneal epithelial cells by targeting KIR4.1 (KCNJ10). Invest Ophthalmol Vis Sci. 2013 Sep 11;54(9):6167-78.
REF 9 Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b. J Biol Chem. 2007 Jan 12;282(2):1479-86.
REF 10 Downregulation of miR-205 modulates cell susceptibility to oxidative and endoplasmic reticulum stresses in renal tubular cells. PLoS One. 2012;7(7):e41462.
REF 11 TMPRSS4 regulates levels of integrin 5 in NSCLC through miR-205 activity to promote metastasis. Br J Cancer. 2014 Feb 4;110(3):764-74.
REF 12 miR-205 expression promotes cell proliferation and migration of human cervical cancer cells. PLoS One. 2012;7(10):e46990.
REF 13 MicroRNA-205-directed transcriptional activation of tumor suppressor genes in prostate cancer. Cancer. 2010 Dec 15;116(24):5637-49.
REF 14 MicroRNA-205 regulates the expression of Parkinson's disease-related leucine-rich repeat kinase 2 protein. Hum Mol Genet. 2013 Feb 1;22(3):608-20.
REF 15 miRNA-205 suppresses melanoma cell proliferation and induces senescence via regulation of E2F1 protein. J Biol Chem. 2011 May 13;286(19):16606-14.
REF 16 SZ-685C exhibits potent anticancer activity in both radiosensitive and radioresistant NPC cells through the miR-205-PTEN-Akt pathway. Oncol Rep. 2013 Jun;29(6):2341-7.
REF 17 miR-205 promotes tumor proliferation and invasion through targeting ESRRG in endometrial carcinoma. Oncol Rep. 2013 Jun;29(6):2297-302.
REF 18 p53-Regulated Networks of Protein, mRNA, miRNA, and lncRNA Expression Revealed by Integrated Pulsed Stable Isotope Labeling With Amino Acids in Cell Culture (pSILAC) and Next Generation Sequencing (NGS) Analyses. Mol Cell Proteomics. 2015 Oct;14(10):2609-29.
REF 19 MicroRNA-205 inhibits tumor cell migration through down-regulating the expression of the LDL receptor-related protein 1. Biochem Biophys Res Commun. 2009 Oct 16;388(2):400-5.
REF 20 The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol. 2008 May;10(5):593-601.
REF 21 MicroRNA-205 acts as a tumor suppressor in osteosarcoma via targeting RUNX2. Oncol Rep. 2016 Jun;35(6):3275-84.
REF 22 MicroRNA profiling of Epstein-Barr virus-associated NK/T-cell lymphomas by deep sequencing. PLoS One. 2012;7(8):e42193.
REF 23 MicroRNA-205 inhibits cancer cell migration and invasion via modulation of centromere protein F regulating pathways in prostate cancer.Int J Urol. 2015 Sep;22(9):867-77.
REF 24 Long non-coding RNA HOTAIR regulates cyclin J via inhibition of microRNA-205 expression in bladder cancer.Cell Death Dis. 2015 Oct 15;6:e1907.
REF 25 Regulative Effect of Mir-205 on Osteogenic Differentiation of Bone Mesenchymal Stem Cells (BMSCs): Possible Role of SATB2/Runx2 and ERK/MAPK Pathway.Int J Mol Sci. 2015 May 7;16(5):10491-506.
REF 26 The role of miR-205 in the VEGF-mediated promotion of human ovarian cancer cell invasion.Gynecol Oncol. 2015 Apr;137(1):125-33.
REF 27 Tumor suppressive function of mir-205 in breast cancer is linked to HMGB3 regulation.PLoS One. 2013 Oct 2;8(10):e76402.
REF 28 MicroRNA-205-directed transcriptional activation of tumor suppressor genes in prostate cancer. Cancer. 2010 Dec 15;116(24):5637-49.
REF 29 Oncosuppressive role of p53-induced miR-205 in triple negative breast cancer. Mol Oncol. 2012 Aug;6(4):458-72.
REF 30 MiR-205 modulates abnormal lipid metabolism of hepatoma cells via targeting acyl-CoA synthetase long-chain family member 1 (ACSL1) mRNA.Biochem Biophys Res Commun. 2014 Feb 7;444(2):270-5.
REF 31 Involvement of cholesterol in hepatitis B virus X protein-induced abnormal lipid metabolism of hepatoma cells via up-regulating miR-205-targeted ACSL4.Biochem Biophys Res Commun. 2014 Mar 14;445(3):651-5.
REF 32 MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9.
REF 33 TGF-1 regulating miR-205/miR-195 expression affects the TGF- signal pathway by respectively targeting SMAD2/SMAD7.Oncol Rep. 2016 Oct;36(4):1837-44.
REF 34 MiR-205 is downregulated in hereditary hemorrhagic telangiectasia and impairs TGF-beta signaling pathways in endothelial cells.Angiogenesis. 2013 Oct;16(4):877-87.
REF 35 A Proteomics Approach to Investigate miR-153-3p and miR-205-5p Targets in Neuroblastoma Cells.PLoS One. 2015 Dec 3;10(12):e0143969.
REF 36 miR-205 targets PTEN and PHLPP2 to augment AKT signaling and drive malignant phenotypes in non-small cell lung cancer. Cancer Res. 2013 Sep 1;73(17):5402-15.
REF 37 MicroRNA-184 antagonizes microRNA-205 to maintain SHIP2 levels in epithelia.Proc Natl Acad Sci U S A. 2008 Dec 9;105(49):19300-5.
REF 38 A systematic evaluation of miRNA:mRNA interactions involved in the migration and invasion of breast cancer cells. J Transl Med. 2013 Mar 5;11:57.
REF 39 miRNA-205 suppresses melanoma cell proliferation and induces senescence via regulation of E2F1 protein. J Biol Chem. 2011 May 13;286(19):16606-14.
REF 40 Down-regulation of microRNA-205 promotes gastric cancer cell proliferation.Eur Rev Med Pharmacol Sci. 2014;18(7):1027-32.
REF 41 E2F1 confers anticancer drug resistance by targeting ABC transporter family members and Bcl-2 via the p73/DNp73-miR-205 circuitry.Cell Cycle. 2012 Aug 15;11(16):3067-78.
REF 42 miR-205-5p-mediated downregulation of ErbB/HER receptors in breast cancer stem cells results in targeted therapy resistance. Cell Death Dis. 2015 Jul 16;6:e1823.
REF 43 The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol. 2008 May;10(5):593-601.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.