miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-208a-3p | ||||
| miRNA Stemloop AC | MI0000251 | ||||
| miRNA Stemloop ID | hsa-mir-208a | ||||
| Sequence | auaagacgagcaaaaagcuugu | ||||
| TTD Target(s) Regulated by This miRNA | Voltage-gated calcium channel alpha Cav1.2 (CACNA1C) | Successful Target | Target Info | [1] | |
| Protein C-ets-1 (ETS1) | Literature-reported Target | Target Info | [2] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Mediator of RNA polymerase II transcription subunit 13 | Regulated Protein | [4] | ||
| Programmed cell death protein 4 | Regulated Protein | [5] | |||
| Protein quaking | Regulated Protein | [6] | |||
| Transcription factor SOX-6 | Regulated Protein | [7] | |||
| Voltage-dependent L-type calcium channel subunit beta-2 | Regulated Protein | [1] | |||
| References | |||||
| REF 1 | miR-208b upregulation interferes with calcium handling in HL-1 atrial myocytes: Implications in human chronic atrial fibrillation. J Mol Cell Cardiol. 2016 Oct;99:162-173. | ||||
| REF 2 | MicroRNA-208 modulates BMP-2-stimulated mouse preosteoblast differentiation by directly targeting V-ets erythroblastosis virus E26 oncogene homolog 1. J Biol Chem. 2010 Sep 3;285(36):27745-52. | ||||
| REF 3 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
| REF 4 | Control of stress-dependent cardiac growth and gene expression by a microRNA.Science. 2007 Apr 27;316(5824):575-9. | ||||
| REF 5 | miR-208a-3p suppresses cell apoptosis by targeting PDCD4 in gastric cancer.Oncotarget. 2016 Oct 11;7(41):67321-67332. | ||||
| REF 6 | Extracellular vesicles-mediated transfer of miR-208a/b exaggerate hypoxia/reoxygenation injury in cardiomyocytes by reducing QKI expression.Mol Cell Biochem. 2017 Jul;431(1-2):187-195. | ||||
| REF 7 | Mir-208 promotes cell proliferation by repressing SOX6 expression in human esophageal squamous cell carcinoma.J Transl Med. 2014 Jul 15;12:196. | ||||
| REF 8 | miR-208b upregulation interferes with calcium handling in HL-1 atrial myocytes: Implications in human chronic atrial fibrillation. J Mol Cell Cardiol. 2016 Oct;99:162-173. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.