miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-20a-3p | ||||
| miRNA Stemloop AC | MI0000076 | ||||
| miRNA Stemloop ID | hsa-mir-20a | ||||
| Sequence | acugcauuaugagcacuuaaag | ||||
| TTD Target(s) Regulated by This miRNA | Smoothened homolog (SMO) | Successful Target | Target Info | [1] | |
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | BH3-interacting domain death agonist | Regulated Protein | [3] | ||
| E3 SUMO-protein ligase EGR2 | Regulated Protein | [4] | |||
| Nuclear receptor subfamily 4 group A member 3 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | miR-20a regulates proliferation, differentiation and apoptosis in P19 cell model of cardiac differentiation by targeting Smoothened. Biol Open. 2016 Sep 15;5(9):1260-5. | ||||
| REF 2 | Resveratrol and pterostilbene epigenetically restore PTEN expression by targeting oncomiRs of the miR-17 family in prostate cancer. Oncotarget. 2015 Sep 29;6(29):27214-26. | ||||
| REF 3 | miR-20a-directed regulation of BID is associated with the TRAIL sensitivity in colorectal cancer.Oncol Rep. 2017 Jan;37(1):571-578. | ||||
| REF 4 | MicroRNA 0a promotes the proliferation and cell cycle of human osteosarcoma cells by suppressing early growth response 2 expression.Mol Med Rep. 2015 Oct;12(4):4989-94. | ||||
| REF 5 | miR-17 and -20a Target the Neuron-Derived Orphan Receptor-1 (NOR-1) in Vascular Endothelial Cells.PLoS One. 2015 Nov 23;10(11):e0141932. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.