miRNA General Information
miRNA Mature ID hsa-miR-20a-5p
miRNA Stemloop AC MI0000076
miRNA Stemloop ID hsa-mir-20a
Sequence uaaagugcuuauagugcagguag
TTD Target(s) Regulated by This miRNA Tyrosine-protein kinase Kit (KIT) Successful Target Target Info [1]
Peroxisome proliferator-activated receptor gamma (PPAR-gamma) Successful Target Target Info [2]
Amyloid beta A4 protein (APP) Successful Target Target Info [3]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [4]
Janus kinase 1 (JAK-1) Successful Target Target Info [5]
Signal transducer and activator of transcription 3 (STAT3) Successful Target Target Info [6]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [7]
TGF-beta receptor type I (TGFBR1) Clinical trial Target Target Info [8]
Wee1-like protein kinase (WEE1) Clinical trial Target Target Info [9]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [10]
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Clinical trial Target Target Info [11]
Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) Clinical trial Target Target Info [12]
Apoptosis signal-regulating kinase 1 (MAP3K5) Clinical trial Target Target Info [13]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [14]
GTPase NRas (NRAS) Clinical trial Target Target Info [3]
TGF-beta receptor type II (TGFBR2) Clinical trial Target Target Info [15]
Gap junction alpha-1 protein (GJA1) Clinical trial Target Target Info [16]
Hypoxia-inducible factor 1 alpha (HIF-1A) Clinical trial Target Target Info [17]
Tumor susceptibility gene protein 101 (TSG101) Clinical trial Target Target Info [18]
E2F transcription factor 1 (E2F1) Clinical trial Target Target Info [19]
Hypoxia-inducible factor 2 alpha (HIF-2A) Clinical trial Target Target Info [20]
Thrombospondin-1 (THBS1) Clinical trial Target Target Info [21]
Stress-activated protein kinase JNK2 (JNK2) Preclinical Target Target Info [9]
Bone morphogenetic protein receptor (BMPR2) Literature-reported Target Target Info [22]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [23]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [24]
Death-associated protein kinase 3 (DAPK3) Literature-reported Target Target Info [25]
LIM domain kinase-1 (LIMK-1) Literature-reported Target Target Info [26]
Protein kinase G1 (PRKG1) Literature-reported Target Target Info [27]
Tyrosine-protein kinase ABL2 (ABL2) Literature-reported Target Target Info [28]
Integrin beta-8 (ITGB8) Patented-recorded Target Target Info [29]
Kinesin-like protein KIF26B (KIF26B) Literature-reported Target Target Info [30]
Melanoma differentiation-associated protein 6 (CDKN1A) Literature-reported Target Target Info [31]
Runt-related transcription factor 3 (RUNX3) Literature-reported Target Target Info [32]
Protein(s) Regulated by This miRNA Autophagy-related protein 16-1 Regulated Protein [33]
Bcl-2-like protein 11 Regulated Protein [34]
BCL2/adenovirus E1B 19 kDa protein-interacting protein 2 Regulated Protein [35]
BMP and activin membrane-bound inhibitor homolog Regulated Protein [2]
Cysteine-rich motor neuron 1 protein Regulated Protein [2]
Dual specificity mitogen-activated protein kinase kinase 3 Regulated Protein [37]
Dual specificity protein phosphatase 2 Regulated Protein [38]
E3 SUMO-protein ligase EGR2 Regulated Protein [39]
Egl nine homolog 3 Regulated Protein [40]
ETS translocation variant 1 Regulated Protein [41]
F-box only protein 31 Regulated Protein [42]
G1/S-specific cyclin-D2 Regulated Protein [9]
Homeobox protein PKNOX1 Regulated Protein [44]
Interferon regulatory factor 2 Regulated Protein [1]
Metalloproteinase inhibitor 2 Regulated Protein [46]
Mitogen-activated protein kinase kinase kinase 12 Regulated Protein [47]
Mothers against decapentaplegic homolog 4 Regulated Protein [48]
Mucin-17 Regulated Protein [49]
Myocyte-specific enhancer factor 2D Regulated Protein [47]
Netrin-4 Regulated Protein [50]
NF-kappa-B inhibitor beta Regulated Protein [51]
PH domain leucine-rich repeat-containing protein phosphatase 2 Regulated Protein [52]
Polycystin-1 Regulated Protein [53]
Progressive ankylosis protein homolog Regulated Protein [54]
RB1-inducible coiled-coil protein 1 Regulated Protein [55]
RE1-silencing transcription factor Regulated Protein [56]
Receptor-type tyrosine-protein phosphatase O Regulated Protein [57]
Regulator of G-protein signaling 5 Regulated Protein [58]
Retinoblastoma-associated protein Regulated Protein [9]
Retinoblastoma-like protein 1 Regulated Protein [9]
Retinoblastoma-like protein 2 Regulated Protein [9]
Rho GTPase-activating protein 12 Regulated Protein [59]
Runt-related transcription factor 1 Regulated Protein [60]
Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform Regulated Protein [57]
Transcription elongation factor A protein-like 1 Regulated Protein [6]
Transcriptional activator protein Pur-alpha Regulated Protein [62]
Transmembrane gamma-carboxyglutamic acid protein 1 Regulated Protein [50]
Tumor protein p53-inducible nuclear protein 1 Regulated Protein [63]
Tyrosine-protein phosphatase non-receptor type substrate 1 Regulated Protein [64]
Ubiquitin-conjugating enzyme E2 C Regulated Protein [65]
Zinc finger FYVE domain-containing protein 9 Regulated Protein [66]
References
REF 1 Integrative nucleophosmin mutation-associated microRNA and gene expression pattern analysis identifies novel microRNA - target gene interactions in acute myeloid leukemia. Haematologica. 2011 Dec;96(12):1783-91.
REF 2 MiRNA-20a promotes osteogenic differentiation of human mesenchymal stem cells by co-regulating BMP signaling. RNA Biol. 2011 Sep-Oct;8(5):829-38.
REF 3 MicroRNA regulation of Alzheimer's Amyloid precursor protein expression. Neurobiol Dis. 2009 Mar;33(3):422-8.
REF 4 miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9.
REF 5 Members of the microRNA-17-92 cluster exhibit a cell-intrinsic antiangiogenic function in endothelial cells. Blood. 2010 Jun 10;115(23):4944-50.
REF 6 HIF-1 downregulates miR-17/20a directly targeting p21 and STAT3: a role in myeloid leukemic cell differentiation. Cell Death Differ. 2013 Mar;20(3):408-18.
REF 7 The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 8 FGF2 inhibits endothelial-mesenchymal transition through microRNA-20a-mediated repression of canonical TGF- signaling. J Cell Sci. 2016 Feb 1;129(3):569-79.
REF 9 MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulate E2F activity on cell cycle arrest during neuronal lineage differentiation of USSC. PLoS One. 2011 Jan 20;6(1):e16138.
REF 10 Upregulation of the miR-17-92 cluster and its two paraloga in osteosarcoma - reasons and consequences. Genes Cancer. 2014 Apr;5(1-2):56-63.
REF 11 Epigenetic regulation of miR-17~92 contributes to the pathogenesis of pulmonary fibrosis. Am J Respir Crit Care Med. 2013 Feb 15;187(4):397-405.
REF 12 Decrease expression of microRNA-20a promotes cancer cell proliferation and predicts poor survival of hepatocellular carcinoma. J Exp Clin Cancer Res. 2013 Apr 18;32(1):21.
REF 13 MiR-20a regulates ASK1 expression and TLR4-dependent cytokine release in rheumatoid fibroblast-like synoviocytes. Ann Rheum Dis. 2013 Jun;72(6):1071-9.
REF 14 MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57.
REF 15 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
REF 16 Suppression of CX43 expression by miR-20a in the progression of human prostate cancer. Cancer Biol Ther. 2012 Aug;13(10):890-8.
REF 17 Identification of hypoxia-inducible factor-1 alpha as a novel target for miR-17-92 microRNA cluster. Cancer Res. 2008 Jul 15;68(14):5540-5.
REF 18 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 19 c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005 Jun 9;435(7043):839-43.
REF 20 MicroRNA-17, 20a regulates the proangiogenic function of tumor-associated macrophages via targeting hypoxia-inducible factor 2. PLoS One. 2013 Oct 23;8(10):e77890.
REF 21 The myc-miR-17~92 axis blunts TGF{beta} signaling and production of multiple TGF{beta}-dependent antiangiogenic factors. Cancer Res. 2010 Oct 15;70(20):8233-46.
REF 22 Interleukin-6 modulates the expression of the bone morphogenic protein receptor type II through a novel STAT3-microRNA cluster 17/92 pathway. Circ Res. 2009 May 22;104(10):1184-91.
REF 23 miR-19 is a key oncogenic component of mir-17-92. Genes Dev. 2009 Dec 15;23(24):2839-49.
REF 24 A cyclin D1/microRNA 17/20 regulatory feedback loop in control of breast cancer cell proliferation. J Cell Biol. 2008 Aug 11;182(3):509-17.
REF 25 Oncogenic miR-17/20a Forms a Positive Feed-forward Loop with the p53 Kinase DAPK3 to Promote Tumorigenesis. J Biol Chem. 2015 Aug 7;290(32):19967-75.
REF 26 MiR-20a is upregulated in anaplastic thyroid cancer and targets LIMK1. PLoS One. 2014 May 23;9(5):e96103.
REF 27 MiR-20a regulates the PRKG1 gene by targeting its coding region in pulmonary arterial smooth muscle cells. FEBS Lett. 2014 Dec 20;588(24):4677-85.
REF 28 miR-20a promotes prostate cancer invasion and migration through targeting ABL2. J Cell Biochem. 2014 Jul;115(7):1269-76.
REF 29 MicroRNA-17/20a functions to inhibit cell migration and can be used a prognostic marker in oral squamous cell carcinoma. Oral Oncol. 2013 Sep;49(9):923-931.
REF 30 MiR-20a-5p represses multi-drug resistance in osteosarcoma by targeting the KIF26B gene. Cancer Cell Int. 2016 Aug 5;16:64.
REF 31 MicroRNA-17-92 down-regulates expression of distinct targets in different B-cell lymphoma subtypes. Blood. 2009 Jan 8;113(2):396-402.
REF 32 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 33 MiR-20a-5p mediates hypoxia-induced autophagy by targeting ATG16L1 in ischemic kidney injury.Life Sci. 2015 Sep 1;136:133-41.
REF 34 miR-103 inhibits proliferation and sensitizes hemopoietic tumor cells for glucocorticoid-induced apoptosis. Oncotarget. 2017 Jan 3;8(1):472-489.
REF 35 miR-20a targets BNIP2 and contributes chemotherapeutic resistance in colorectal adenocarcinoma SW480 and SW620 cell lines.Acta Biochim Biophys Sin (Shanghai). 2011 Mar;43(3):217-25.
REF 36 MiRNA-20a promotes osteogenic differentiation of human mesenchymal stem cells by co-regulating BMP signaling. RNA Biol. 2011 Sep-Oct;8(5):829-38.
REF 37 miR-20a represses endothelial cell migration by targeting MKK3 and inhibiting p38 MAP kinase activation in response to VEGF.Angiogenesis. 2012 Dec;15(4):593-608.
REF 38 Hypoxia-induced microRNA-20a expression increases ERK phosphorylation and angiogenic gene expression in endometriotic stromal cells.J Clin Endocrinol Metab. 2012 Aug;97(8):E1515-23.
REF 39 Involvement of miR-20a in promoting gastric cancer progression by targeting early growth response 2 (EGR2).Int J Mol Sci. 2013 Aug 6;14(8):16226-39.
REF 40 MicroRNA-20a inhibits stress-induced cardiomyocyte apoptosis involving its novel target Egln3/PHD3.J Mol Cell Cardiol. 2012 Mar;52(3):711-7.
REF 41 MiR-17-92 and miR-221/222 cluster members target KIT and ETV1 in human gastrointestinal stromal tumours. Br J Cancer. 2013 Sep 17;109(6):1625-35.
REF 42 F-box protein FBXO31 is down-regulated in gastric cancer and negatively regulated by miR-17 and miR-20a.Oncotarget. 2014 Aug 15;5(15):6178-90.
REF 43 MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulate E2F activity on cell cycle arrest during neuronal lineage differentiation of USSC. PLoS One. 2011 Jan 20;6(1):e16138.
REF 44 The miR-17 2 cluster contributes to MLL leukemia through the repression of MEIS1 competitor PKNOX1.Leuk Res. 2016 Jul;46:51-60.
REF 45 Integrative nucleophosmin mutation-associated microRNA and gene expression pattern analysis identifies novel microRNA - target gene interactions in acute myeloid leukemia. Haematologica. 2011 Dec;96(12):1783-91.
REF 46 Oncogenic miR-20a and miR-106a enhance the invasiveness of human glioma stem cells by directly targeting TIMP-2.Oncogene. 2015 Mar 12;34(11):1407-19.
REF 47 Down-regulation of miR-17 family expression in response to retinoic acid induced neuronal differentiation. Cell Signal. 2009 Dec;21(12):1837-45.
REF 48 MicroRNA-20a-5p promotes colorectal cancer invasion and metastasis by downregulating Smad4.Oncotarget. 2016 Jul 19;7(29):45199-45213.
REF 49 DNA methylation and histone H3-K9 modifications contribute to MUC17 expression.Glycobiology. 2011 Feb;21(2):247-56.
REF 50 MiR-17-92 cluster promotes hepatocarcinogenesis. Carcinogenesis. 2015 Oct;36(10):1213-22.
REF 51 miR-20a enhances cisplatin resistance of human gastric cancer cell line by targeting NFKBIB.Tumour Biol. 2016 Jan;37(1):1261-9.
REF 52 The miRNA-17 2 cluster mediates chemoresistance and enhances tumor growth in mantle cell lymphoma via PI3K/AKT pathway activation.Leukemia. 2012 May;26(5):1064-72.
REF 53 Conditional loss of kidney microRNAs results in congenital anomalies of the kidney and urinary tract (CAKUT).J Mol Med (Berl). 2013 Jun;91(6):739-48.
REF 54 Matrix stiffness promotes cartilage endplate chondrocyte calcification in disc degeneration via miR-20a targeting ANKH expression.Sci Rep. 2016 May 4;6:25401.
REF 55 MiR-20a and miR-20b negatively regulate autophagy by targeting RB1CC1/FIP200 in breast cancer cells.Life Sci. 2016 Feb 15;147:143-52.
REF 56 The miR-20-Rest-Wnt signaling axis regulates neural progenitor cell differentiation.Sci Rep. 2016 Mar 21;6:23300.
REF 57 MiR-17-92 represses PTPROt and PP2A phosphatases and amplifies tonic BCR signaling in DLBCL cells.Exp Hematol. 2017 Feb;46:56-61.e1.
REF 58 Focal DNA copy number changes in neuroblastoma target MYCN regulated genes.PLoS One. 2013;8(1):e52321.
REF 59 Identification of direct targets for the miR-17-92 cluster by proteomic analysis. Proteomics. 2011 Sep;11(17):3531-9.
REF 60 MicroRNAs 17-5p-20a-106a control monocytopoiesis through AML1 targeting and M-CSF receptor upregulation.Nat Cell Biol. 2007 Jul;9(7):775-87.
REF 61 HIF-1 downregulates miR-17/20a directly targeting p21 and STAT3: a role in myeloid leukemic cell differentiation. Cell Death Differ. 2013 Mar;20(3):408-18.
REF 62 Translation of Pur- is targeted by cellular miRNAs to modulate the differentiation-dependent susceptibility of monocytes to HIV-1 infection.FASEB J. 2012 Nov;26(11):4755-64.
REF 63 miR-17-5p/20a are important markers for gastric cancer and murine double minute 2 participates in their functional regulation. Eur J Cancer. 2013 May;49(8):2010-21.
REF 64 MicroRNA-17/20a/106a modulate macrophage inflammatory responses through targeting signal-regulatory protein .J Allergy Clin Immunol. 2013 Aug;132(2):426-36.e8.
REF 65 Inhibition of microRNA-17/20a suppresses cell proliferation in gastric cancer by modulating UBE2C expression.Oncol Rep. 2015 May;33(5):2529-36.
REF 66 MicroRNA-17/20a impedes migration and invasion via TGF-/ITGB6 pathway in esophageal squamous cell carcinoma. Am J Cancer Res. 2016 Jul 1;6(7):1549-62.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.