miRNA General Information
miRNA Mature ID	hsa-miR-20b-3p
miRNA Stemloop AC	MI0001519
miRNA Stemloop ID	hsa-mir-20b
Sequence	acuguaguaugggcacuuccag
TTD Target(s) Regulated by This miRNA	Nuclear receptor coactivator 3 (NCOA3)	Literature-reported Target	Target Info	[1]
References
REF 1	Decreased expression of microRNA-17 and microRNA-20b promotes breast cancer resistance to taxol therapy by upregulation of NCOA3. Cell Death Dis. 2016 Nov 10;7(11):e2463.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.