miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-215-5p | ||||
| miRNA Stemloop AC | MI0000291 | ||||
| miRNA Stemloop ID | hsa-mir-215 | ||||
| Sequence | augaccuaugaauugacagac | ||||
| TTD Target(s) Regulated by This miRNA | Dihydrofolate reductase (DHFR) | Successful Target | Target Info | [1] | |
| X-linked inhibitor of apoptosis protein (XIAP) | Clinical trial Target | Target Info | [2] | ||
| Lysine-specific histone demethylase 1B (KDM1B) | Patented-recorded Target | Target Info | [3] | ||
| Activin receptor type IIB (ACVR2B) | Literature-reported Target | Target Info | [4] | ||
| Thymidylate synthase (TYMS) | Clinical trial Target | Target Info | [5] | ||
| Activated leukocyte cell adhesionmolecule (ALCAM) | Clinical trial Target | Target Info | [2] | ||
| Zinc finger E-box-binding homeobox 2 (ZEB2) | Literature-reported Target | Target Info | [6] | ||
| Protein(s) Regulated by This miRNA | Beta-catenin-interacting protein 1 | Regulated Protein | [7] | ||
| Nidogen-1 | Regulated Protein | [8] | |||
| Receptor-type tyrosine-protein phosphatase T | Regulated Protein | [9] | |||
| Retinoblastoma-associated protein | Regulated Protein | [10] | |||
| Runt-related transcription factor 1 | Regulated Protein | [11] | |||
| Serine/threonine-protein kinase WNK1 | Regulated Protein | [12] | |||
| Sialic acid-binding Ig-like lectin 8 | Regulated Protein | [13] | |||
| References | |||||
| REF 1 | A miR-24 microRNA binding-site polymorphism in dihydrofolate reductase gene leads to methotrexate resistance. Proc Natl Acad Sci U S A. 2007 Aug 14;104(33):13513-8. | ||||
| REF 2 | Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12. | ||||
| REF 3 | MiR-215 Is Induced Post-transcriptionally via HIF-Drosha Complex and Mediates Glioma-Initiating Cell Adaptation to Hypoxia by Targeting KDM1B. Cancer Cell. 2016 Jan 11;29(1):49-60. | ||||
| REF 4 | miR-192, miR-194, miR-215, miR-200c and miR-141 are downregulated and their common target ACVR2B is strongly expressed in renal childhood neoplasms. Carcinogenesis. 2012 May;33(5):1014-21. | ||||
| REF 5 | Molecular mechanism of chemoresistance by miR-215 in osteosarcoma and colon cancer cells. Mol Cancer. 2010 Apr 30;9:96. | ||||
| REF 6 | miRNA profiling in metastatic renal cell carcinoma reveals a tumour-suppressor effect for miR-215. Br J Cancer. 2011 Nov 22;105(11):1741-9. | ||||
| REF 7 | Functional implications of microRNA-215 in TGF-1-induced phenotypic transition of mesangial cells by targeting CTNNBIP1.PLoS One. 2013;8(3):e58622. | ||||
| REF 8 | Nidogen-1 is a common target of microRNAs MiR-192/215 in the pathogenesis of Hirschsprung's disease.J Neurochem. 2015 Jul;134(1):39-46. | ||||
| REF 9 | Hepatitis B virus X protein mutant HBx127 promotes proliferation of hepatoma cells through up-regulating miR-215 targeting PTPRT.Biochem Biophys Res Commun. 2014 Feb 7;444(2):128-34. | ||||
| REF 10 | MiR-215 modulates gastric cancer cell proliferation by targeting RB1.Cancer Lett. 2014 Jan 1;342(1):27-35. | ||||
| REF 11 | miR-215 promotes malignant progression of gastric cancer by targeting RUNX1.Oncotarget. 2016 Jan 26;7(4):4817-28. | ||||
| REF 12 | Regulation of WNK1 expression by miR-192 and aldosterone.J Am Soc Nephrol. 2010 Oct;21(10):1724-31. | ||||
| REF 13 | Role of MiR-215 in Hirschsprung's Disease Pathogenesis by Targeting SIGLEC-8.Cell Physiol Biochem. 2016;40(6):1646-1655. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.